Transcript asmbl_119530

Sequence
Transcript Sequence for observation asmbl_119530 of TGE0056955:
CTCTGCCCCGAGGCCTAGCTTGGCCAGAAGGTAGCAGACAGACAGACGGATCTAACCTCTCTTGGATCCTCCAGCCATGAGGCTGCTCTGGGGGCTGATCTGGGCATCCAGCTTCTTCACCTTATCTCTGCAGAAGCCCAGGTTGCTCTTGTTCTCTCCTTCTGTGGTTCATCTGGGGGTCCCCCTATCGGTGGGGGTGCAGCTCCAGGATGTGCCCCGAGGACAGGTAGTGAAAGGATCAGTGTTCCTGAGAAACCCATCTCGTAATAATGTCCCCTGCTCCCCAAAGGTGGACTTCACCCTTAGCTCAGAAAGAGACTTTGCACTCCTCAGTCTCCAGGTGCCCTTGAAAGATGCGAAGAGCTGTGGCCTCCATCAACTCCTCAGAGGCCCTGAGGTCCAGCTGGTGGCCCATTCGCCATGGCTAAAGGACTCTCTGTCCAGAACGACAAACATCCAGGGTATCAACCTGCTCTTCTCCTCTCGCCGGGGGCACCTCTTTTTGCAGACGGACCAGCCCATTTACAACCCTGGCCAGCGGGTTCGGTACCGGGTCTTTGCTCTGGATCAGAAGATGCGCCCGAGCACTGACACCATCACAGTCATGGTGGAGAACTCTCACGGCCTCCGCGTGCGGAAGAAGGAGGTGTACATGCCCTCGTCCATCTTCCAGGATGACTTTGTGATCCCAGACATCTCAGAGCCAGGGACCTGGAAGATCTCAGCCCGATTCTCAGATGGCCTGGAATCCAACAGCAGCACCCAGTTTGAGGTGAAGAAATATGTCCTTCCCAACTTTGAGGTGAAGATCACCCCTGGAAAGCCCTACATCCTGACGGTGCCAGGCCATCTTGATGAAATGCAGTTAGACATCCAGGCCAGGTACATCTATGGGAAGCCAGTGCAGGGGGTGGCATATGTGCGCTTTGGGCTCCTAGATGAGGATGGTAAGAAGACTTTCTTTCGGGGGCTGGAGAGTCAGACCAAGCTGGTGAATGGACAGAGCCACATTTCCCTCTCAAAGGCAGAGTTCCAGGACGCCCTGGAGAAGCTGAATATGGGCATTACTGACCTCCAGGGGCTGCGCCTCTACGTTGCTGCAGCCATCATTGAGTCTCCAGGTGGGGAGATGGAGGAGGCAGAGCTCACATCCTGGTATTTTGTGTCATCTCCCTTCTCCTTGGATCTTAGCAAGACCAAGCGACACCTTGTGCCTGGGGCCCCCTTCCTGCTGCAGGCCTTGGTCCGTGAGATGTCAGGCTCCCCAGCTTCTGGCATTCCTGTCAAAGTTTCTGCCACGGTGTCTTCTCCTGGGTCTGTTCCTGAAGTCCAGGACATTCAGCAAAACACAGACGGGAGCGGCCAAGTCAGCATTCCAATAATTATCCCTCAGACCATCTCAGAGCTGCAGCTCTCAGTATCTGCAGGCTCCCCACATCCAGCGATAGCCAGGCTCACTGTGGCAGCCCCACCTTCAGGAGGCCCCGGGTTTCTGTCTATTGAGCGGCCGGATTCTCGACCTCCTCGTGTTGGGGACACTCTGAACCTGAACTTGCGAGCCGTGGGCAGTGGGGCCACCTTTTCTCATTACTACTACATGATCCTATCCCGAGGGCAGATCGTGTTCATGAATCGAGAGCCCAAGAGGACCCTGACCTCGGTCTCGGTGTTTGTGGACCATCACCTGGCACCCTCCTTCTACTTTGTGGCCTTCTACTACCATGGAGACCACCCAGTGGCCAACTCCCTGCGAGTGGATGTCCAGGCTGGGGCCTGCGAGGGCAAGCTGGAGCTCAGCGTGGACGGTGCCAAGCAGTACCGGAACGGGGAGTCCGTGAAGCTCCACTTAGAAACCGACTCCCTAGCCCTGGTGGCGCTGGGAGCCTTGGACACAGCTCTGTATGCTGCAGGCAGCAAGTCCCACAAGCCCCTCAACATGGGCAAGGTCTTTGAAGCTATGAACAGCTATGACCTCGGCTGTGGTCCTGGGGGTGGGGACAGTGCCCTTCAGGTGTTCCAGGCAGCGGGCCTGGCCTTTTCTGATGGAGACCAGTGGACCTTATCCAGAAAGAGACTAAGCTGTCCCAAGGAGAAGACAACCCGGAAAAAGAGAAACGTGAACTTCCAAAAGGCGATTAATGAGAAATTGGGTCAGTATGCTTCCCCGACAGCCAAGCGCTGCTGCCAGGATGGGGTGACACGTCTGCCCATGATGCGTTCCTGCGAGCAGCGGGCAGCCCGCGTGCAGCAGCCGGACTGCCGGGAGCCCTTCCTGTCCTGCTGCCAATTTGCTGAGAGTCTGCGCAAGAAGAGCAGGGACAAGGGCCAGGCGGGCCTCCAACGAGCCCTGGAGATCCTGCAGGAGGAGGACCTGATTGATGAGGATGACATTCCCGTGCGCAGCTTCTTCCCAGAGAACTGGCTCTGGAGAGTGGAAACAGTGGACCGCTTTCAAATATTGACACTGTGGCTCCCCGACTCTCTGACCACGTGGGAGATCCATGGCCTGAGCCTGTCCAAAACCAAAGGCCTATGTGTGGCCACCCCAGTCCAGCTCCGGGTGTTCCGCGAGTTCCACCTGCACCTCCGCCTGCCCATGTCTGTCCGCCGCTTTGAGCAGCTGGAGCTGCGGCCTGTCCTCTATAACTACCTGGATAAAAACCTGACTGTGAGCGTCCACGTGTCCCCAGTGGAGGGGCTGTGCCTGGCTGGGGGCGGAGGGCTGGCCCAGCAGGTGCTGGTGCCTGCGGGCTCTGCCCGGCCTGTTGCCTTCTCTGTGGTGCCCACGGCAGCCGCCGCTGTGTCTCTGAAGGTGGTGGCTCGAGGGTCCTTCGAATTCCCTGTGGGAGATGCGGTGTCCAAGGTTCTGCAGATTGAGAAGGAAGGGGCCATCCATAGAGAGGAGCTGGTCTATGAACTCAACCCCTTGGACCACCGAGGCCGGACCTTGGAAATACCTGGCAACTCTGATCCCAATATGATCCCTGATGGGGACTTTAACAGCTACGTCAGGGTTACAGCCTCAGATCCATTGGACACTTTAGGCTCTGAGGGGGCCTTGTCACCAGGAGGCGTGGCCTCCCTCTTGAGGCTTCCTCGAGGCTGTGGGGAGCAAACCATGATCTACTTGGCTCCGACACTGGCTGCTTCCCGCTACCTGGACAAGACAGAGCAGTGGAGCACACTGCCTCCCGAGACCAAGGACCACGCCGTGGATCTGATCCAGAAAGGCTACATGCGGATCCAGCAGTTTCGGAAGGCGGATGGTTCCTATGCGGCTTGGTTGTCACGGGGCAGCAGCACCTGGCTCACAGCCTTTGTGTTGAAGGTCCTGAGTTTGGCCCAGGAGCAGGTAGGAGGCTCGCCTGAGAAACTGCAGGAGACATCTAACTGGCTTCTGTCCCAGCAGCAGGCTGACGGCTCGTTCCAGGACCTCTCTCCAGTGATACATAGGAGCATGCAGGGGGGTTTGGTGGGCAATGATGAGACTGTGGCACTCACAGCCTTTGTGACCATCGCCCTTCATCATGGGCTGGCCGTCTTCCAGGATGAGGGTGCAGAGCCATTGAAGCAGAGAGTGGAAGCCTCCATCTCAAAGGCAAACTCATTTTTGGGGGAGAAAGCAAGTGCTGGGCTCCTGGGTGCCCACGCAGCTGCCATCACGGCCTATGCCCTGACACTGACCAAGGCCCCTGCGGACCTGCGGGGTGTTGCCCACAACAACCTCATGGCAATGGCCCAGGAGACTGGAGATAACCTGTACTGGGGCTCAGTCACTGGTTCTCAGAGCAATGCCGTGTCGCCCACCCCGGCTCCTCGCAACCCATCCGACCCCATGCCCCAGGCCCCAGCCCTGTGGATTGAAACCACAGCCTACGCCCTGCTGCACCTCCTGCTTCACGAGGGCAAAGCAGAGATGGCAGACCAGGCTGCGGCCTGGCTCACCCGTCAGGGCAGCTTCCAAGGGGGATTCCGCAGTACCCAAGACACGGTGATTGCCCTGGATGCCCTGTCTGCCTACTGGATTGCCTCCCACACCACTGAGGAGAGGGGTCTCAATGTGACTCTCAGCTCCACAGGCCGGAATGGGTTCAAGTCCCACGCGCTGCAGCTGAACAACCGCCAGATTCGCGGCCTGGAGGAGGAGCTGCAGTTTTCCTTGGGCAGCAAGATCAATGTGAAGGTGGGAGGAAACAGCAAAGGAACCCTGAAGGTCCTTCGTACCTACAATGTCCTGGACATGAAGAACACGACCTGCCAGGACCTACAGATAGAAGTGACAGTCAAAGGCCACGTCGAGTACACGATGGAAGCAAACGAGGACTATGAGGACTATGAGTACGATGAGCTTCCAGCCAAGGATGACCCAGATGCCCCTCTGCAGCCCGTGACACCCCTGCAGCTGTTTGAGGGTCGGAGGAACCGCCGCAGGAGGGAGGCGCCCAAGGTGGTGGAGGAGCAGGAGTCCAGGGTGCACTACACCGTGTGCATCTGGCGGAACGGCAAGGTGGGGCTGTCTGGCATGGCCATCGCGGACGTCACCCTCCTGAGTGGATTCCACGCCCTGCGTGCTGACCTGGAGAAGCTGACCTCCCTCTCTGACCGTTACGTGAGTCACTTTGAGACCGAGGGGCCCCACGTCCTGCTGTATTTTGACTCGGTCCCCACCTCCCGGGAGTGCGTGGGCTTTGAGGCTGTGCAGGAAGTGCCGGTGGGGCTGGTGCAGCCGGCCAGCGCAACCCTGTACGACTACTACAACCCCGAGCGCAGATGTTCTGTGTTTTACGGGGCACCAAGTAAGAGCAGACTCTTGGCCACCTTGTGTTCTGCTGAAGTCTGCCAGTGTGCTGAGGGGAAGTGCCCTCGCCAGCGTCGCGCCCTGGAGCGGGGTCTGCAGGACGAGGATGGCTACAGGATGAAGTTTGCCTGCTACTACCCCCGTGTGGAGTACGGCTTCCAGGTTAAGGTTCTCCGAGAAGACAGCAGAGCTGCTTTCCGCCTCTTTGAGACCAAGATCACCCAAGTCCTGCACTTCACCAAGGATGTCAAGGCCGCTGCTAATCAGATGCGCAACTTCCTGGTTCGAGCCTCCTGCCGCCTTCGCTTGGAACCTGGGAAAGAATATTTGATCATGGGTCTGGATGGGGCCACCTATGACCTCGAGGGACACCCCCAGTACCTGCTGGACTCGAATAGCTGGATCGAGGAGATGCCCTCTGAACGCCTGTGCCGGAGCACCCGCCAGCGGGCAGCCTGTGCCCAGCTCAACGACTTCCTCCAGGAGTATGGCACTCAGGGGTGCCAGGTGTGAGGGCTGCCCTCCCACCTCCGCTGGGAGGAACCTGAACCTGGGAACCATGAAGCTGGAAGCACTGCTGTGTCCGCTTTCATGAACACAGCCTGGGACCAGGGCATATTAAAGGCTTTTGGCAGCAAAGTGTCAGTGTTGGCAGCGAAGTGTCAGTGTGTGTTGCTAGGGCTGAGAGCAGTGCCCCTGCCCGATGCAGTTCTGGGCAGGCCAGGTTGACATAACCTTAGACTCTCTGAGCCCTGATGACCCTTGGGCTGTTCAGCTCTGCTAGAACCTCCCAGATGACCCGCTAGGAGTCTAGTGCTTCACAGGACCACCCCGAGCAGAACTGGGACCCAAGAGCCTGCACCCCAAGGACCAGAGTCCATGCCAAGACCACCCTTCAGCTTCCAAGGCCCTCCACTGCCCGGCTGTCGCCAGTCACCACGGCCTCAGACAGGGCTTGTGCTCAGCTGACACCTGTGACACAGCTCTTCTGCCTCATGAGCTGTTGTCCAGCTACACCTCCCCGACTCTGTCCTCGTGCTGCTGGCGGTTCTGAGGTCTGCAGATTTTAGCTGAGTTCCGGGCTGTTGAAAGCCTGCTGACGCTTGGTTCTGTTATCAGTGGAATGAGGTGACTTTCCCGGAGTTGTGCAATCCTCAGGTCCGGCAGTGTCTTCTTCCAGTTACTGGTTTCAAACAAGCCAAAAGTCTGACTTTGGTGTGTTTGTGAATCCTCTGAGGAAGCCGCTGTTCTCCTGGGGTCTCCCCTTCCCACCGGACCTGCCTAACTTTCCCCCATTTAGTGGCACACCTGGGGTCTTCAGAGATGACTCCGCGTCTGTCCAAAGAAGTTTGGTGAGATCAGTTTCCGTAGAGGTCATGACAGTTCA