Transcript asmbl_11884

Sequence
Transcript Sequence for observation asmbl_11884 of TGE0056954:
ATTTCCCGGGGTGGGAACGCCGGGAGGCGGGAGGAGAGGGGGCTGCCAGGGGCGTCCGGTTACATCCCCGCCTTCCTCTGTCCTGGCCGCGGGACCGGGTTTGCGGGACCGCAGTTCGGGAACATGTTGGCCTCGAGCAGCCGGATCCGGGCTGCGTGGACGCGGGCGCTGCTGCTGCCGCTGCTGCTGGCGGGGCCTGTGGGCTGCCTGAGCCGCCAGGAGCTCTTTCCCTTCGGCCCCGGACAGGGGGACCTGGAGCTGGAGGACGGGGATGACTTCGTCTCTCCTGCCCTGGAGCTGAGTGGGGCGCTCCGCTTCTACGACAGATCCGACATCGACGCAGTCTACGTCACCACAAATGGCATCATTGCTACGAGTGAACCCCCGGCCAAAGAATCCCATCCCGGGCTCTTCCCACCAACATTCGGTGCAGTCGCCCCTTTCCTGGCGGACTTGGACACGACCGATGGCCTGGGGAAGGTTTATTATCGAGAAGACTTATCCCCCTCCATCACTCAGCGAGCAGCAGAGTGTGTCCACAGAGGGTTCCCGGAGATCTCTTTCCAGCCTAGTAGCGCGGTGGTTGTCACTTGGGAATCCGTGGCCCCCTACCAAGGGCCCAGCAGGGACCCAGACCAGAAAGGCAAGAGAAACACGTTCCAGGCTGTTCTAGCCTCCTCTGATTCCAGCTCCTATGCCATTTTCCTTTATCCTGAGGATGGTCTGCAGTTCCATACGACATTCTCAAAGAAGGAAAACAACCAAGTTCCTGCCGTGGTTGCATTCAGTCAAGGTTCAGTGGGATTCTTATGGAAGAGCAACGGAGCTTATAACATATTTGCTAATGACAGGGAATCAGTTGAAAATTTGGCCAAGAGTAGTAACTCTGGGCAGCAGGGTGTCTGGGTGTTTGAGATTGGGAGTCCAGCCACCACCAATGGCGTGGTGCCTGCAGACGTGATCCTCGGAACTGAAGATGGGGCAGAGTATGATGATGAGGATGAAGATTATGACCTGGCGACCACTCGTCTGGGCCTGGAGGATGTGGGCACCACGCCCTTCTCCTACAAGGCTCTGAGAAGGGGAGGTGCTGACACATACAGTGTGCCCAGCGTCCTCTCCCCGCGCCGGGCAGCTACCGAAAGGCCCCTTGGACCTCCCACAGAGAGAACCAGGTCTTTCCAGTTGGCAGTGGAGACTTTTCACCAGCAGCACCCTCAGGTCATAGATGTGGATGAAGTTGAGGAAACAGGAGTTGTTTTCAGCTATAACACGGATTCCCGCCAGACGTGTGCTAACAACAGACACCAGTGCTCGGTGCACGCAGAGTGCAGGGACTACGCCACGGGCTTCTGCTGCAGCTGTGTCGCTGGCTATACGGGCAATGGCAGGCAATGTGTTGCAGAAGGTTCCCCCCAGCGAGTCAATGGCAAGGTGAAAGGAAGGATCTTTGTGGGGAGCAGCCAGGTCCCCATTGTCTTTGAGAACACTGACCTCCACTCTTACGTAGTAATGAACCACGGGCGCTCCTACACAGCCATCAGCACCATTCCCGAGACCGTTGGATATTCTCTGCTTCCACTGGCCCCAGTTGGAGGCATCATTGGATGGATGTTTGCAGTGGAGCAGGACGGATTCAAGAATGGGTTCAGCATCACCGGGGGTGAGTTCACTCGCCAGGCTGAGGTGACCTTCGTGGGGCACCCGGGCAATCTGGTCATTAAGCAGCGGTTCAGCGGCATCGATGAGCATGGGCACCTGACCATCGACACGGAGCTGGAGGGCCGCGTGCCGCAGATTCCGTTCGGCTCCTCCGTGCACATTGAGCCCTACACGGAGCTGTACCACTACTCCACCTCAGTGATCACTTCCTCCTCCACCCGGGAGTACACGGTGACTGAGCCCGAGCGAGATGGGGCATCTCCTTCACGCATCTACACTTACCAGTGGCGCCAGACCATCACCTTCCAGGAATGCGTCCACGATGACTCCCGGCCAGCCCTGCCCAGCACCCAGCAGCTCTCGGTGGACAGCGTGTTCGTCCTGTACAACCAGGAGGAGAAGATCTTGCGCTATGCTCTCAGCAACTCCATTGGGCCTGTGAGGGAAGGCTCCCCTGATGCTCTTCAGAATCCCTGCTACATCGGCACTCATGGGTGTGACACCAACGCGGCCTGTCGCCCTGGTCCCAGGACACAGTTCACCTGCGAGTGCTCCATCGGCTTCCGAGGAGACGGGCGAACCTGCTATGATATTGATGAATGTTCAGAACAACCCTCAGTGTGTGGGAGCCACACAATCTGCAATAATCACCCAGGAACCTTCCGCTGCGAGTGTGTGGAGGGCTACCAGTTTTCAGATGAGGGAACGTGTGTGGCTGTCGTGGACCAGCGCCCCATCAACTACTGTGAAACTGGCCTTCATAACTGCGACATACCCCAGCGGGCCCAGTGTATCTACACAGGAGGCTCCTCCTACACCTGTTCCTGCTTGCCAGGCTTTTCTGGGGATGGCCAAGCCTGCCAAGATGTAGATGAATGCCAGCCAAGCCGATGTCACCCTGACGCCTTCTGCTACAACACTCCAGGCTCTTTCACGTGCCAGTGCAAACCTGGTTATCAGGGAGACGGCTTCCGTTGCGTGCCCGGAGAGGTGGAGAAAACCCGGTGCCAGCACGAGCGAGAACACATTCTCGGGGCAGCGGGGGCGACAGACCCACAGCGACCCATTCCTCCGGGGCTGTTCGTTCCTGAGTGCGATGCGCACGGGCACTACGCGCCCACCCAGTGCCACGGCAGCACCGGCTACTGCTGGTGCGTGGATCGCGACGGCCGCGAGGTGGAGGGCACCAGGACCAGGCCCGGGATGACGCCCCCGTGTCTGAGTACAGTGGCTCCCCCGATTCACCAAGGACCTGCGGTGCCTACCGCCGTGATCCCCTTGCCTCCTGGGACCCATTTACTCTTTGCCCAGACTGGGAAGATTGAGCGCCTGCCCCTGGAGGGAAATACCATGAGGAAGACAGAAGCAAAGGCGTTCCTTCATGTCCCGGCTAAAGTCATCATTGGACTGGCCTTTGACTGCGTGGACAAGATGGTTTACTGGACGGACATCACTGAGCCTTCCATTGGGAGAGCTAGTCTACATGGTGGAGAGCCAACCACCATCATTAGACAAGATCTTGGAAGTCCAGAAGGTATCGCTGTTGATCACCTTGGCCGCAACATCTTCTGGACAGACTCTAACCTGGATCGAATAGAAGTGGCGAAGCTGGACGGCACGCAGCGCCGGGTGCTCTTTGAGACTGACTTGGTGAATCCCAGAGGCATTGTAACGGATTCCGTGAGAGGGAACCTTTACTGGACAGACTGGAACAGAGATAACCCCAAGATTGAAACTTCCTACATGGACGGCACGAACCGGAGGATCCTTGTGCAGGATGACCTGGGCTTGCCCAATGGACTGACCTTCGATGCGTTCTCATCTCAGCTCTGCTGGGTGGATGCAGGCACCAATCGGGCGGAATGCCTGAACCCCAGTCAGCCCAGCAGACGCAAGGCTCTCGAAGGGCTCCAGTATCCTTTTGCTGTGACGAGCTACGGGAAGAATCTGTATTTCACAGACTGGAAGATGAATTCCGTGGTTGCTCTCGATCTTGCAATTTCCAAGGAGACGGATGCTTTCCAACCCCACAAGCAGACCCGGCTGTATGGCATCACCACGGCCCTGTCTCAGTGTCCGCAAGGCCATAACTACTGCTCAGTGAACAATGGCGGCTGCACCCACCTATGCTTGGCCACCCCAGGGAGCAGGACCTGCCGTTGCCCTGACAACACCTTGGGAGTTGACTGTATCGAACAGAAATGAAGACAAGAGTGCCTTATTTCCTTTCCAAGTATTTCACAGCAACACTCTACTTGAAGCAACTTGGTCCAGATTGAAAAGTGTCCTCTGGCTGAGTGGCCACTAGGCCCAGACCCAGCCCAGCCTGAGCCCCAACAACTTTTCCCTCACTGTTCCCCAAAACATGCACCCTGGACTTCTCTAATAGAAAAGTCTCCACCCCTACACAAGGACAGAACCCTCCACCCCTACCCCCAACCCTCAGACAGACTTATACACCCCTGAGTGAGGATTACATGCCCATCCCAGTGTCCTAGGACCTTTTCCCAATACTAGCCCCCCAGTGGTGAACAGAACCTCCCAAATTTGAGTTGCACCCTTCCCTGTGGCCTTATGAGCTCAGCCTCGCTTTGAGGTACCCACCGTCCTGTCAGCTCCTTGACCTATGAGCCGGGGCCTGACTAGGAAAAGTTGGGAGTTAAGGAGGAAATTAGCATTCCTTAATGTTTTGTTTTGGTGCTCTGAATTTCTTCTTTATTATAGTCCTATAGTTTTACTCCTCAGTTCCTCACCATCATCATCTTGTCTAAGACCCCCATTATAATATTCATGCGCTGCTTTTTCATCAAAACCTACCCTGTCCTAGAGATCTATGGGCATTTGGTGGATGATAATGAGCAGCCCCTCCCAGATAGAATGTCAATATTTGAGCAGTAGGATATTGGCATTTGTTAGTTAAAGGCTTAAATCAAAAGAATGTCCAATGGTAGGAATTTCAAGGTGTAGGTCAGATATTTGAGAATAGGGGATTTTTTTGATGTGCCTTAAATTATACCAAAGATTACTAATTATTCCTCTTTGCCCAAAATACTTGCATCCAAGGTTCTAGTCTCTGTTGCTGTGCTGGTCTTTAGCCCCACTGCTTGCACTGATGTCCCTCCTTTTCACGGAGACCTATCTGAGGTACAGGATGGGGCTGGCACCAGATGATGTCCCACCACAGTCCCTCACCTCCGGCCTCCACATGACAGAACCAATTTACACTCAACCATGACCTCACCCCTCCTTGGTTTCTCCCTCGATCTGTGGCCCTTTTTGGATGTATTCTTATCTAACAACACAATCCGGAAAGACTGAATTGAATATTTATACTAATGGTTCATATCCTTTATTGCTCAATGATCTAATTAAAGGGATCATTGCCACATTTCATGTTTATATTTCTACAATTTGTTTAGAAAACATCTCCTGACCATATCAGTAGCTCGTGTTATCTTTTTATCAACTGCTTCCCAGAGTCCTAAAACAATAGAAATTTTGGATTGAAAAGTTCAGCATAAGGAGTTTGAGTCAGTAAAGGATGGGATAAAGGAGTCGAGATGATTCAATGAAAAGTATCACAAAAAAGAGATTGATCAACAAGAGAAATAAAAAAGCCCAAGAGGAAGTGGTAGGGGAAGGAATTTAAGAACAGCAATAAGTAAAACTCTTAAGTAACTCCAAAAAGAAAATGGTACATTTTGCCAAAGACCACTTATACTTGAGAACATGGAAGAATTTGCCTGATACTCTCTTTGGGGAAAAGAGTCTCTCCTCTTTTCCTCAAACCCCAGTACACTCAGCCTCTCTGCCCCACCTTCTCCTGACTTTGTCCTCACTTGCTTCTGCAGTACATTGGAACCTGAATTGAAAGAAAGTCTTCCTTGAATAATTGGAGTTTGTCTTGAGAGGCAAATATAGCCCCAAGAATCACAAGATTCGAGGACCATGTAGGTCTTTTACGTAGCCCAAATCCATAAATTAGTCTCACTTTTTGTATTTATCGTTTCATATTAAACCCTCTATATCAAATGTTCATCATGATTTTGTATGATTTTTATAACTATTTTATTCATTTTATTAGATTTATTCTAAAATTTTTTAATGGTAAATTCTTAAACTGTGGAAACCACTGAAGGTGCTTATTAACTGTTCTCCCAGATTTGTACAAGTATTGGATGATTCCTTGAGTTTACAGCTGTACAAATAGTGTGGAAA