Transcript asmbl_118473

Sequence
Transcript Sequence for observation asmbl_118473 of TGE0056953:
CTCTGCCCCGAGGCCTAGCTTGGCCAGAAGGTAGCAGACAGACAGACGGATCTAACCTCTCTTGGATCCTCCAGCCATGAGGCTGCTCTGGGGGCTGATCTGGGCATCCAGCTTCTTCACCTTATCTCTGCAGAAGCCCAGGTTGCTCTTGTTCTCTCCTTCTGTGGTTCATCTGGGGGTCCCCCTATCGGTGGGGGTGCAGCTCCAGGATGTGCCCCGAGGACAGGTAGTGAAAGGATCAGTGTTCCTGAGAAACCCATCTCGTAATAATGTCCCCTGCTCCCCAAAGGTGGACTTCACCCTTAGCTCAGAAAGAGACTTCGCACTCCTCAGTCTCCAGGTGCCCTTGAAAGATGCGAAGAGCTGTGGCCTCCATCAACTCCTCAGAGGCCCTGAGGTCCAGCTGGTGGCCCATTCGCCATGGCTAAAGGACTCTCTGTCCAGAACGACAAACATCCAGGGTATCAACCTGCTCTTCTCCTCTCGCCGGGGGCACCTCTTTTTGCAGACGGACCAGCCCATTTACAACCCTGGCCAGCGGGTTCGGTACCGGGTCTTTGCTCTGGATCAGAAGATGCGCCCGAGCACTGACACCATCACAGTCATGGTGGAGAACTCTCACGGCCTCCGCGTGCGGAAGAAGGAGGTGTACATGCCCTCGTCCATCTTCCAGGATGACTTTGTGATCCCAGACATCTCAGAGCCAGGGACCTGGAAGATCTCAGCCCGATTCTCAGATGGCCTGGAATCCAACAGCAGCACCCAGTTTGAGGTGAAGAAATATGTCCTTCCCAACTTTGAGGTGAAGATCACCCCTGGAAAGCCCTACATCCTGACGGTGCCAGGCCATCTTGATGAAATGCAGTTAGACATCCAGGCCAGGTACATCTATGGGAAGCCAGTGCAGGGGGTGGCATATGTGCGCTTTGGGCTCCTAGATGAGGATGGTAAGAAGACTTTCTTTCGGGGGCTGGAGAGTCAGACCAAGCTGGTGAATGGACAGAGCCACATTTCCCTCTCAAAGGCAGAGTTCCAGGACGCCCTGGAGAAGCTGAATATGGGCATTACTGACCTCCAGGGGCTGCGCCTCTACGTTGCTGCAGCCATCATTGAGTCTCCAGGTGGGGAGATGGAGGAGGCAGAGCTCACATCCTGGTATTTTGTGTCATCTCCCTTCTCCTTGGATCTTAGCAAGACCAAGCGACACCTTGTGCCTGGGGCCCCCTTCCTGCTGCAGGCCTTGGTCCGTGAGATGTCAGGCTCCCCAGCTTCTGGCATTCCTGTCAAAGTTTCTGCCACGGTGTCTTCTCCTGGGTCTGTTCCTGAAGTCCAGGACATTCAGCAAAACACAGACGGGAGCGGCCAAGTCAGCATTCCAATAATTATCCCTCAGACCATCTCAGAGCTGCAGCTCTCAGTATCTGCAGGCTCCCCACATCCAGCGATAGCCAGGCTCACTGTGGCAGCCCCACCTTCAGGAGGCCCCGGGTTTCTGTCTATTGAGCGGCCGGATTCTCGACCTCCTCGTGTTGGGGACACTCTGAACCTGAACTTGCGAGCCGTGGGCAGTGGGGCCACCTTTTCTCATTACTACTACATGATCCTATCCCGAGGGCAGATCGTGTTCATGAATCGAGAGCCCAAGAGGACCCTGACCTCGGTCTCGGTGTTTGTGGACCATCACCTGGCACCCTCCTTCTACTTTGTGGCCTTCTACTACCATGGAGACCACCCAGTGGCCAACTCCCTGCGAGTGGATGTCCAGGCTGGGGCCTGCGAGGGCAAGCTGGAGCTCAGCGTGGACGGTGCCAAGCAGTACCGGAACGGGGAGTCCGTGAAGCTCCACTTAGAAACCGACTCCCTAGCCCTGGTGGCGCTGGGAGCCTTGGACACAGCTCTGTATGCTGCAGGCAGCAAGTCCCACAAGCCCCTCAACATGGGCAAGGTCTTTGAAGCTATGAACAGCTATGACCTCGGCTGTGGTCCTGGGGGTGGGGACAGTGCCCTTCAGGTGTTCCAGGCAGCGGGCCTGGCCTTTTCTGATGGAGACCAGTGGACCTTATCCAGAAAGAGACTAAGCTGTCCCAAGGAGAAGACAACCCGGAAAAAGAGAAACGTGAACTTCCAAAAGGCGATTAATGAGAAATTGGGTCAGTATGCTTCCCCGACAGCCAAGCGCTGCTGCCAGGATGGGGTGACACGTCTGCCCATGATGCGTTCCTGCGAGCAGCGGGCAGCCCGCGTGCAGCAGCCGGACTGCCGGGAGCCCTTCCTGTCCTGCTGCCAATTTGCTGAGAGTCTGCGCAAGAAGAGCAGGGACAAGGGCCAGGCGGGCCTCCAACGAGCCCTGGAGATCCTGCAGGAGGAGGACCTGATTGATGAGGATGACATTCCCGTGCGCAGCTTCTTCCCAGAGAACTGGCTCTGGAGAGTGGAAACAGTGGACCGCTTTCAAATATTGACACTGTGGCTCCCCGACTCTCTGACCACGTGGGAGATCCATGGCCTGAGCCTGTCCAAAACCAAAGGCCTATGTGTGGCCACCCCAGTCCAGCTCCGGGTGTTCCGCGAGTTCCACCTGCACCTCCGCCTGCCCATGTCTGTCCGCCGCTTTGAGCAGCTGGAGCTGCGGCCTGTCCTCTATAACTACCTGGATAAAAACCTGACTGTGAGCGTCCACGTGTCCCCAGTGGAGGGGCTGTGCCTGGCTGGGGGCGGAGGGCTGGCCCAGCAGGTGCTGGTGCCTGCGGGCTCTGCCCGGCCTGTTGCCTTCTCTGTGGTGCCCACGGCAGCCGCCGCTGTGTCTCTGAAGGTGGTGGCTCGAGGGTCCTTCGAATTCCCTGTGGGAGATGCGGTGTCCAAGGTTCTGCAGATTGAGAAGGAAGGGGCCATCCATAGAGAGGAGCTGGTCTATGAACTCAACCCCTTGGACCACCGAGGCCGGACCTTGGAAATACCTGGCAACTCTGATCCCAATATGATCCCTGATGGGGACTTTAACAGCTACGTCAGGGTTACAGCCTCAGATCCATTGGACACTTTAGGCTCTGAGGGGGCCTTGTCACCAGGAGGCGTGGCCTCCCTCTTGAGGCTTCCTCGAGGCTGTGGGGAGCAAACCATGATCTACTTGGCTCCGACACTGGCTGCTTCCCGCTACCTGGACAAGACAGAGCAGTGGAGCACACTGCCTCCCGAGACCAAGGACCACGCCGTGGATCTGATCCAGAAAGGCTACATGCGGATCCAGCAGTTTCGGAAGGCGGATGGTTCCTATGCGGCTTGGTTGTCACGGGACAGCAGCACCTGGCTCACAGCCTTTGTGTTGAAGGTCCTGAGTTTGGCCCAGGAGCAGGTAGGAGGCTCGCCTGAGAAACTGCAGGAGACATCTAACTGGCTTCTGTCCCAGCAGCAGGCTGACGGCTCGTTCCAGGACCTCTCTCCAGTGATACATAGGAGCATGCAGGGGGGTTTGGTGGGCAATGATGAGACTGTGGCACTCACAGCCTTTGTGACCATCGCCCTTCATCATGGGCTGGCCGTCTTCCAGGATGAGGGTGCAGAGCCATTGAAGCAGAGAGTGGAAGCCTCCATCTCAAAGGCAAGCTCATTTTTGGGGGAGAAAGCAAGTGCTGGGCTCCTGGGTGCCCACGCAGCTGCCATCACGGCCTATGCCCTGACACTGACCAAGGCCCCTGCGGACCTGCGGGGTGTTGCCCACAACAACCTCATGGCAATGGCCCAGGAGACTGGAGATAACCTGTACTGGGGCTCAGTCACTGGTTCTCAGAGCAATGCCGTGTCGCCCACCCCGGCTCCTCGCAACCCATCCGACCCCATGCCCCAGGCCCCAGCCCTGTGGATTGAAACCACAGCCTACGCCCTGCTGCACCTCCTGCTTCACGAGGGCAAAGCAGAGATGGCAGACCAGGCTGCGGCCTGGCTCACCCGTCAGGGCAGCTTCCAAGGGGGATTCCGCAGTACCCAAGACACGGTGATTGCCCTGGATGCCCTGTCTGCCTACTGGATTGCCTCCCACACCACTGAGGAGAGGGGTCTCAATGTGACTCTCAGCTCCACAGGCCGGAATGGGTTCAAGTCCCACGCGCTGCAGCTGAACAACCGCCAGATTCGCGGCCTGGAGGAGGAGCTGCAGTTTTCCTTGGGCAGCAAGATCAATGTGAAGGTGGGAGGAAACAGCAAAGGAACCCTGAAGGTCCTTCGTACCTACAATGTCCTGGACATGAAGAACACGACCTGCCAGGACCTACAGATAGAAGTGACAGTCAAAGGCCACGTCGAGTACACGATGGAAGCAAACGAGGACTATGAGGACTATGAGTACGATGAGCTTCCAGCCAAGGATGACCCAGATGCCCCTCTGCAGCCCGTGACACCCCTGCAGCTGTTTGAGGGTCGGAGGAACCGCCGCAGGAGGGAGGCGCCCAAGGTGGTGGAGGAGCAGGAGTCCAGGGTGCACTACACCGTGTGCATCTGGCGGAACGGCAAGGTGGGGCTGTCTGGCATGGCCATCGCGGACGTCACCCTCCTGAGTGGATTCCACGCCCTGCGTGCTGACCTGGAGAAGCTGACCTCCCTCTCTGACCGTTACGTGAGTCACTTTGAGACCGAGGGGCCCCACGTCCTGCTGTATTTTGACTCGGTCCCCACCTCCCGGGAGTGCGTGGGCTTTGAGGCTGTGCAGGAAGTGCCGGTGGGGCTGGTGCAGCCGGCCAGCGCAACCCTGTACGACTACTACAACCCCGAGCGCAGATGTTCTGTGTTTTACGGGGCACCAAGTAAGAGCAGACTCTTGGCCACCTTGTGTTCTGCTGAAGTCTGCCAGTGTGCTGAGGGGAAGTGCCCTCGCCAGCGTCGCGCCCTGGAGCGGGGTCTGCAGGACGAGGATGGCTACAGGATGAAGTTTGCCTGCTACTACCCCCGTGTGGAGTACGGCTTCCAGGTTAAGGTTCTCCGAGAAGACAGCAGAGCTGCTTTCCGCCTCTTTGAGACCAAGATCACCCAAGTCCTGCACTTCACCAAGGATGTCAAGGCCGCTGCTAATCAGATGCGCAACTTCCTGGTTCGAGCCTCCTGCCGCCTTCGCTTGGAACCTGGGAAAGAATATTTGATCATGGGTCTGGATGGGGCCACCTATGACCTCGAGGGACACCCCCAGTACCTGCTGGACTCGAATAGCTGGATCGAGGAGATGCCCTCTGAACGCCTGTGCCGGAGCACCCGCCAGCGGGCAGCCTGTGCCCAGCTCAACGACTTCCTCCAGGAGTATGGCACTCAGGGGTGCCAGGTGTGAGGGCTGCCCTCCCACCTCCGCTGGGAGGAACCTGAACCTGGGAACCATGAAGCTGGAAGCACTGCTGTGTCCGCTTTCATGAACACAGCCTGGGACCAGGGCATATTAAAGGCTTTTGGCAGCAAAGTGTCAGTGTTGGCAGTGAAGTGTCAGTGTGTGTTGCTAGGGCTGAGAGCAGTGCCCCTGCCCGATGCAGTTCTGGGCAGGCCAGGTTGACATAACCTTAGACTCTCTGAGCCCTGATGACCCTTGGGCTGTTCAGCTCTGCTAGAACCTCCCAGATGACCCGCTAGGAGTCTAGTGCTTCACAGGACCACCCCGAGCAGAACTGGGACCCAAGAGCCTGCACCCCAAGGACCAGAGTCCATGCCAAGACCACCCTTCAGCTTCCAAGGCCCTCCACTGCCCGGCTGTCGCCAGTCACCACGGCCTCAGACAGGGCTTGTGCTCAGCTGACACCTGTGACACAGCTCTTCTGCCTCATGAGCTGTTGTCCAGCTACACCTCCCCGACTCTGTCCTCGTGCTGCTGGCGGTTCTGAGGTCTGCAGATTTTAGCTGAGTTCCGGGCTGTTGAAAGCCTGCTGACGCTTGGTTCTGTTATCAGTGGAATGAGGTGACTTTCCCGGAGTTGTGCAATCCTCAGGTCCGGCAGTGTCTTCTTCCAGTTACTGGTTTCAAACAAGCCAAAAGTCTGACTTTGGTGTGTTTGTGAATCCTCTGAGGAAGCCGCTGTTCTCCTGGGGTCTCCCCTTCCCACCGGACCTGCCTAACTTTCCCCCATTTAGTGGCACACCTGGGGTCTTCAGAGATGACTCCGCGTCTGTCCAAAGAAGTTTGGTGAGATCAGTTTCCGTAGAGGTCATGACAGTTCA