Transcript asmbl_11846

Sequence
Transcript Sequence for observation asmbl_11846 of TGE0000511:
CGCTGGACTGAGAGTGGCCAGCATTAACAACTCTTTTATTTGAAAACGTGGGTGGCTCTGAAAAGAGCCTTTTGAGTTCACAGGTGCCCCTTCGAGACGCGGGCCGGGCTGGGCCCACTTGGGCCGGACGTCAGCCTCACTTGCCCTTTGCCTTGTGGTGACTCTCCGTCTTCTTAGGGAGCAGTACGGCCTGGATGTTAGGCAAGACGCCGCCCTGGGCGATGGTGACTTTGCCCAGCAGCTTGTTCAGTTCCTCGTCGTTGCGGATGGCCAGCTGGAGGTGACGAGGGATGATGCGCGTCTTCTTGTTGTCCCGAGCCGCGTTGCCCGCCAGCTCCAGGATCTCGGCGGTCAGATACTCGAGGACCGCAGCCATGTAGACGGGCGCGCCGGCCCCCACTCGCTCCGCGTAGTTGCCTTTGCGCAGCAAGCGATGCACTCGCCCTACCGGGAACTGAAGGCCAGCGCGGGACGAGCGCGACTTGGCCTTGGCGCGGGCCTTGCCTCCTTGCTTGCCACGACCAGACATGACAGCGATAGTAGTCACCGAGAGAAACTCCTGCCTGGCGATCGGGAAAGTCGCCGAAAACGCCGCTGCTTCACCTTTTTATAGACAGAACGGCGATTGTCCACGGAGCACTTTGATTGGCTCAAGCAAATTTTGTCCCGATAGCCAATAGGATAGCTCAGCCAGAATCCACTCATTTACATAATCTCGTCTCCCTCGCATTGCGCGCCGCGGAAAACTCGCGAACCATAACGCAGCGTCATGCGCACAGCCTCTGTAAGTACACAGTCGTTTCCGGTAGACCCCGAGCCTACCGCTCTGCTTGCGTTCTCGGGGGTCGGTGTCGGTCTTGGGTCTGGCCATGCCTGAGCCTGCAAAGTTCGCGCCGGCTCCCAAGAAGGGCTCCAAGAAAGCCGTCACCAAAGCCCAGAAGAAAGACGGCAAGAAGCGCAAGCGCAGCCGCAAGGAGAGCTACTCCATCTACGTGTACAAGGTGCTGAAGCAGGTCCACCCCGACACCGGCATCTCGTCCAAGGCCATGGGCATCATGAACTCCTTCGTCAACGACATCTTCGAGCGCATCGCGGGAGAGGCGTCCCGCCTGGCGCACTACAACAAGCGCTCCACCATCACATCCCGCGAGATCCAGACGGCCGTGCGCCTGCTGCTGCCCGGCGAGCTGGCCAAGCACGCCGTGTCCGAGGGCACCAAGGCGGTCACCAAGTACACCAGCTCGAAGTAA