Transcript asmbl_118394

Sequence
Transcript Sequence for observation asmbl_118394 of TGE0056697:
TACCTATAAAAGCGGCCATGTTTTACATATTTCTTGATTTTGTTTGTTTTCTCGTGAGCTTAGGCCGCTGGTTTTGGTGATTTTTGTCTGATTGCAATGTCTGGACGTGGTAAGCAAGGAGGCAAAGCTCGCGCCAAAGCGAAATCCCGCTCTTCTCGCGCTGGTCTCCAGTTCCCGGTGGGCCGAGTGCACCGCCTGCTCCGTAAAGGCAACTACGCAGAGCGGGTTGGGGCAGGCGCGCCGGTGTACCTGGCGGCGGTGTTAGAGTACCTGACCGCCGAGATCCTGGAGCTGGCCGGCAACGCGGCTCGCGACAACAAGAAGACTCGCATCATCCCGCGCCACTTGCAGCTGGCCATCCGCAACGACGAGGAGCTCAACAAACTGCTAGGCCGGGTGACCATTGCTCAGGGCGGCGTCCTTCCTAACATCCAGGCCGTGCTTCTGCCTAAGAAGACCGAGAGTCACCACAAGGCCAAGGGCAAGTGATTTGACAGGTATCTGAGCTCCCGGAAACGCTATCAAACCCAAAGGCTCTTTTCAGAGCCCCCCTACCGTTTCAAAGGAAGAGCTAACCTCACTGCTTGTAGGTAGAAGGAAAAAAGGCACTAAGAAAATGTCTTCTGAGGCTGATCTGGTGTCTCACATCTGTAATCCCAGCACTTGGGGAGGCTGAGGCAGAAGAATCACTTGAACCCCGGGAGGTGGAGGTTGTAGTGA