Transcript asmbl_118393

Sequence
Transcript Sequence for observation asmbl_118393 of TGE0056697:
TACCTATAAAAGCGGCCATGTTTTACATATTTCTTGATTTTGTTTGTTTTCTCGTGAGCTTAGGCCGCTGGTTTTGGTGATTTTTGTCTGATTGCAATGTCTGGACGTGGTAAGCAAGGAGGCAAAGCTCGCGCCAAAGCGAAATCCCGCTCTTCTCGCGCTGGTCTCCAGTTCCCGGTGGGCCGAGTGCACCGCCTGCTCCGTAAAGGCAACTACGCAGAGCGGGTTGGGGCAGGCGCGCCGGTGTACCTGGCGGCGGTGTTAGAGTACCTGACCGCCGAGATCCTGGAGCTGGCCGGCAACGCGGCTCGCGACAACAAGAAGACTCGCATCATCCCGCGCCACTTGCAGCTGGCCATCCGCAACGACGAGGAGCTCAACAAACTGCTAGGCCGGGTGACCATTGCTCAGGGCGGCGTCCTTCCTAACATCCAGGCCGTGCTTCTGCCTAAGAAGACCGAGAGTCACCACAAGGCCAAGGGCAAGTGATTTGACAGGTTGCAAAAGCTTCTCATTTCAGAGAGATGCCAGGATCCTAAGTGCCTGCCAAACTTACCAATTCTAAGGAATAAGTGGATGGATGGCATTACTGATTCCTACATTACTGATTGATTCTGCATCCGCAAATTGTTTTATTAAAAACATTCTACATCATGTGTGGGGAGATAAGGAGGATAAAATGAAGAGAAAGAATATTATTGAGGGGAAGTTCTTCTGAATACAAAATGTGTTTAATTTTTTAAATAAGTATTACATTCACAGGGTTCAAACTATTTGAAGTAAAGAGATTATATATAAAGAATCCATCCCTCAACTTACCCAGGTGGTCACTTTTCTTTTTCTTGTGTATCTGCCCAGTATTCATTCCTGCTGATATCAGTCAATAATGAATGATACGTGTTTTCTTCACTTTTTTCATTCTTGTCAGGTAGCAGACTGTGTAGACTTTTCTGCACTTGCCCTTTTCATAACAATCTATCTTGGAGAACTTTCCCTATGAGAACATACAGAGCTTCCTGTACACAGTTGCATGTACTGCATTATGCAAATGCATTATATTTTATGTAACCTGTCCACTGTTGGTAGGCACTTGAGTTGTTTTAGTCTTTTGCTATCAAACAGTTCTGGGATGATTAACCCTGATTTACTGCAAAATTGAAATTGCTCTGCTATTCTGCTGGAATGGTGGTAAGTGAACTGAAAATTCCAGTCACTCTTGGGCTAGACTCAACGTTCTTAAAAACTATGTGGCCATCACCAAATTAGTTATTTTGAACCTTAATTTCTTCACCTCTAAAATGGAGGTAATACTTACCTTAAGTGGCTATGAGAATGAAGATCATGTGTATGAATTGTTGGTGCTCTAAAGAACAGCACAAATAAAATTATTTTCAAATTTAATTTTAATTGAACTATGTGTAATTTCTTAATTTTGAAATAATTTTATTTGTAATGTGCATAATCTTATTTAATGTATAATGTATACATTGTAATAGAAACAGATTTCCCAAATTCCAGCCTGGCATGAGGTAATAAAAGGTAATGCAAAG