Transcript asmbl_114134

Sequence
Transcript Sequence for observation asmbl_114134 of TGE0056697:
CCTTAGTGCCTTTTTTCCTTCTACCTACAAGCAGTGAGGTTAGCTCTTCCTTTGAAACGGTAGGGGGGCTCTGAAAAGAGCCTTTGGGTTTGATAGCGTTTCCGGGAGCTCAGATACCTGTCAAATCACTTGCCCTTGGCCTTGTGGTGACTCTCGGTCTTCTTAGGCAGAAGCACGGCCTGGATGTTAGGAAGGACGCCGCCCTGAGCAATGGTCACCCGGCCTAGCAGTTTGTTGAGCTCCTCGTCGTTGCGGATGGCCAGCTGCAAGTGGCGCGGGATGATGCGAGTCTTCTTGTTGTCGCGAGCCGCGTTGCCGGCCAGCTCCAGGATCTCGGCGGTCAGGTACTCTAACACCGCCGCCAGGTACACCGGCGCGCCTGCCCCAACCCGCTCTGCGTAGTTGCCTTTACGGAGCAGGCGGTGCACTCGGCCCACCGGGAACTGGAGACCAGCGCGAGAAGAGCGGGATTTCGCTTTGGCGCGAGCTTTGCCTCCTTGCTTACCACGTCCAGACATTGCAATCAGACAAAAATCACCAAAACCAGCGGCCTAAGCTCACGAGAAAACAAACAAAATCAAGAAATATGTAAAACATGGCCGCTTTTATAGGTA