Transcript asmbl_113005

Sequence
Transcript Sequence for observation asmbl_113005 of TGE0056424:
GGGAGTAGAAGGTAAAAAGGGAGTGGTGAGAATGAATGTGAGAAGGAAGCCAGGACAGCGCAGTCCCCAGTCCCGAACGGCCAGGGAGAGGAGGTGGCCTAGCGCTGGCGGGGCTCACCCCAATCCGTCTGCCTTTTGATGCCGTACTGTAAGCTCCGTCCATCTCTGCTGGTTGCGCAGCCACCTCGGGATACTGCACACGGAGAGGAGGGAAAATAAGCGAGGCACCGCCGCACCACGCGGGAGACCTACGGAGACCCACAGCGCCCGAGCCCTGGAAGAGCACTACTGGATGTCAGCGGAGAAATGGCTTTGAGCTCAGCCTGGCGCTCGGTTCTGCCTCTGTGGCTCCTCTGGAGCGCTGCCTGCTCCCGCGCCGCGTCCGGGGACGACAACGCTTTTCCTTTTGACATTGAAGGGAGCTCAGCGGTTGGCAGGCAAGACCCGCCTGAGACGAGCGAACCCCGCGTGGCTCTGGGACGCCTGCCGCCTGCGGCCGAGAAATGCAATGCTGGATTCTTTCACACCCTGTCGGGAGAATGTGTGCCCTGCGACTGTAATGGCAATTCCAACGAGTGTTTGGACGGCTCAGGATACTGTGTGCACTGCCAGCGGAACACAACAGGAGAGCACTGTGAAAAGTGTCTGGATGGTTATATCGGAGATTCCATCAGGGGAGCACCCCAATTCTGCCAGCCGTGCCCCTGTCCCCTGCCCCACTTGGCCAATTTTGCAGAATCCTGCTATAGGAAAAATGGAGCTGTTCGGTGCATTTGTAACGAAAATTATGCTGGACCTAACTGTGAAAGATGTGCTCCCGGTTACTATGGAAACCCCTTACTCATTGGAAGCACCTGTAAGAAATGTGACTGCAGTGGAAATTCAGATCCCAACCTGATCTTTGAAGATTGTGATGAAGTCACTGGCCAGTGTAGGAATTGCTTACGCAACACCACCGGATTCAAGTGTGAACGTTGCGCTCCTGGCTACTATGGGGACGCCAGGATAGCCAAGAACTGTGCAGTGTGCAACTGCGGGGGAGGCCCATGTGACAGTGTAACCGGAGAATGCTTGGAAGAAGGTTTTGAACCCCCTACAGGCATGGACTGCCCAACCATAAGTAAAAATAACAGTACATGATTGACTAACCCCACTTTCTCTAATGTGCTGCAGGTGTGGGATTAAGAAAAGCTATGCAATATCACTCTCTAGAAACTGCTGAGTCCCACCCCTGGACTTAACCCTTTCTGCACCTCAGCAAATGGAGCCTGCACCAAGTACTTGGTGGTCCACTTGATTCCCTAGGGCAAATGGGTGGTTTACATTTGCATAGCTCTATTTTATCCAGTCTTTACATTCAGAA