Transcript asmbl_113004

Sequence
Transcript Sequence for observation asmbl_113004 of TGE0056402:
TGTGATAAGTGCGTCTGGGACCTGACTGATGACCTGCGGTTAGCAGCGCTCTCCATCGAGGAAGGCAAATCCGGGGTGCTGAGCGTATCCTCTGGGGCCGCCGCTCATAGGCACGTGAATGAAATCAACGCCACCATCTACCTCCTCAAAACAAAATTGTCAGAAAGAGAAAACCAATACGCCCTAAGAAAGATACAAATCAACAATGCTGAGAACACGATGAAAAGCCTTCTGTCTGACGTAGAGGAATTAGTTGAAAAGCACTGGAACAAGCCAAGAAGAAGACTGGAATTGCAGGAAGGAGTATAATGACTCAGAAGACAGTGTCCATTCAGAGAGCCCACAGTTTATGAAGGGACTGATGACCACATTGCCGCTGCACAGTGGGCTCTGTGACTACAGGAGCCTTGCTCTGTAGGGAGGGGATTACCCTTCTCCAATAAAAAGCCTCTGGGCATGTGTTTGTTATAATACCATTTCTGCATTCTCTTCCTTGACCATCTGAGAGGGCCACTTGCTTGGGTTATTCCTGGAGAGTGTAAAAACGTTCCCGG