Transcript asmbl_112789

Sequence
Transcript Sequence for observation asmbl_112789 of TGE0056946:
CCCTCCCTTCTCCCCGCCCCCCAGCGGGGCACTGCTACTACGGCGATCGCCACCTCACGCCGAAGGAATGCTCGAAGTATGCACACGTTCCCAAAAGTAGACCTCCTTCACCGCCGGAGGAGCATACATCACCCCGTGGCAGCCGTCCACCTTCTCAGGCGTTTCGTAACCGAGTAAACTGAGAGCTGGGAACAGCCCTCTATTAAGTAGCCCGCGGCGCGGAGTCTCTTTCCACTTGGCTAAGGCGAACCGCCCCAGACGCGTCCGCGCGCCGGCAGCTGCAGGCTCAGGCCATCTCCAGTCTTCCTGCCGCGCCCGCCTCTCCTCCTGGGATTCTCCTCCTCCTCCTGGACTTCCCCGCAGCTGCCCACGCCTCGGCGGCCGCCAGGTGCTCCTGGAGTGCAGCGCCTATCGCCGGGGCGTGTGGGGGCCACACCGAGCACCAGCTTCTCCGACGCCGGGAAGCCGCTGTCGCCGCCGCTACCTCTCCCTGTTGCCGCCGCCTCAGATCTCTTCATGCCGCTGTAAGCTCGGAGGCCAAGGATGCGGAGTAGGCTTCCCCCAGCGCTTGCCGCCCTGGGCGCGGCCCTGCTCCTGTCTTCCATTGAGGCAGAAGTTGACCCACCTTCAGACTTGAATTTTAAAATTATAGATGAAAATACTGTTCATATGTCATGGGCAAAACCAGTTGATCCAATTGTGGGTTACAGAATAACGGTGGACCCTACAACGGATGGGCCTACTAAAGAATTTACCCTTTCAGCTAGTACCACTGAAACTTTATTGTCAGAACTTGTACCTGAAACAGAGTATGTGGTGACAATAACTTCATATGATGAAGTAGAAGAAAGTGTACCAGTTATAGGACAACTAACAATTCAAACAGGTAGTTCGACAAAGCCAGTGGAGAAGAAACCTGGAAAAACCGAGATACAAAAATGCTCTGTCAGTGCCTGGACTGATTTGGTTTTCCTCGTGGATGGCTCTTGGAGTGTGGGAAGAAATAATTTCAAGTACATTTTAGACTTCATTGCTGCTCTTGTGTCTGCTTTTGACATTGGGGAAGAGAAGACAAGAGTTGGAGTTGTTCAATACAGCTCTGATACCAGGACTGAATTTAACTTAAATCAGTACTACCAAAGGGATGAACTTCTTGCTGCAATAAAAAAAATTCCATATAAAGGTGGCAACACAATGACAGGGGATGCCATTGATTATTTAGTTAAAAATACTTTCACGGAATCTGCTGGGGCAAGAGTTGGCTTTCCTAAAGTGGCAATTATTATTACGGATGGAAAATCCCAGGATGAAGTGGAAATTCCAGCAAGAGAGCTTCGTAATGTTGGAGTTGAAGTTTTCTCCTTGGGCATTAAAGCTGCAGATGCAAAAGAACTCAAACAAATTGCCTCCACACCTTCACTGAACCATGTTTTCAATGTGGCCAACTTTGATGCAATTGTGGATATTCAGAATGAGATCATCTCCCAGGTGTGCTCAGGTGTTGATGAACAACTTGGTGAATTGGTTAGTGGAGAAGAAGTTGTTGAGCCTCCTTCAAATTTGATTGCCATGGAAGTCTCTTCAAAATATGTTAAGCTAAATTGGAATCCATCTCCTAGTCCAGTGACTGGCTACAAAGTCATCCTCACACCAATGACTGCAGGAAGCCGACAGCACGCTCTGAGTGTGGGGCCTCAGACAACCACGCTCAGTGTTCGCGACCTCTCAGCAGACACAGAATACCAGATCAGTGTTTCCGCCATGAAGGGAATGACATCCAGTGAACCCATTTCAATAATGGAGAAGACTCAGCCAATGAAAGTTCAAGTGGAATGCTCACGTGGTGTGGATATAAAAGCCGATATTGTGTTTTTGGTTGATGGCTCCTATAGCATTGGGATTGCAAACTTTGTTAAAGTTAGAGCCTTTTTGGAAGTTCTTGTAAAAAGTTTTGAAATTTCACCAAATAGGGTCCAGATTAGTCTTGTGCAATACAGCCGGGATCCTCATACTGAGTTCACTTTGAAAAAATTCACCAAAGTTGAAGATATAATTGAAGCAATAAACACCTTCCCTTACAGAGGAGGATCTACAAATACTGGCAAAGCAATGACTTATGTCAGAGAGAAAATATTTGTGCCTAGCAAGGGATCAAGAAGCAATGTGCCAAAGGTCATGATTCTTATCACGGATGGGAAATCATCAGATGCTTTCAGAGATCCTGCGATAAAACTGAGGAATTCAGATGTTGAAATCTTTGCAGTTGGTGTGAAGGATGCCGTTCGCTCAGAATTGGAAGCTATTGCCTCTCCTCCTGCAGAGACCCATGTGTTCACAGTGGAAGATTTTGATGCTTTTCAGAGGATATCTTTTGAACTCACACAGTCTATCTGCCTTAGAATTGAGCAAGAATTGGCAGCTATAAAGAAGAAAGCTTACGTCCCTCCAAAGGATCTTAGTTTTTCAGAAGTGACTTCTTATGGTTTCAAAACCAACTGGTCTCCAGCTGGAGAAAATGTTTTTTCATATCACATCACCTACAAGGAAGCGGCTGGGGATGATGAGGTCACTGTGGTGGAGCCAGCATCGAGCACCAGTGTTGTTCTCAGCAGCCTGAAGCCAGAGACCTTGTATTTGGTCAATGTGACTGCGGAGTATGAGGATGGCTTCAGCATTCCCTTAGCTGGAGAGGAGACCACCGAAGAAGTAAAAGGAGCACCTCGAAACCTAAAGGTGACAGATGAGACTACAGATAGTTTCAAAATTACTTGGACTCAAGCTCCAGGGAGAGTTTTAAGATATCGAATTATATATAGACCAGTTGCTGGTGGAGAGAGCAGAGAAGTTACCACCCCACCCAATCAGAGGAGGAGAACACTGGAGAACTTGATTCCAGACACGAAATATGAAGTATCTGTAATTCCTGAATATTTCTCAGGACCTGGTACTCCATTAACTGGAAATGCAGCCACTGAAGAAGTTAGAGGGAATCCAAGAGACTTAAGAGTTTCTGACCCTACGACGTCTACTATGAAATTATCTTGGAGTGGGGCACCAGGAAAAGTGAAACAGTATCTCGTCACATATACCCCAGTGGCAGGGGGTGAAACTCAAGAGGTCACTGTGAGGGGAGATACAACCAATACGGTGCTGCAGGGATTGAAGGAAGGGACACAATACGCCTTATCTGTGACAGCCTTGTATGCGTCTGGGGCTGGAGACGCCCTCTTTGGTGAAGGAACAACACTTGAAGAACGTGGTTCTCCTCAAGATTTAGTTACTAAAGACATCACTGACACATCAATTGGGGCTTATTGGACATCTGCTCCAGGAATGGTTCGCGGTTACAGGGTCTCATGGAAATCACTTTATGATGATGTTGACACTGGAGAGAAAAATCTGCCTGAAGATGCAATTCATACGATGATAGAAAATCTGCAGCCAGAGACCAAATACAGAATTTCAGTATTTGCCACTTACAGCAGTGGAGAAGGAGAACCTTTGACTGGAGATGCCACAACTGAATTATCTCAAGATTCCAAAACCCTGAAAGTAGATGAAGAAACAGAAAACACAATGAGAGTTACATGGAAACCAGCACCAGGGAAAGTCGTCAACTACCGTGTTGTCTATCGCCCTCATGGGAGAGGGAAGCAAATGGTTGCTAAGGTGCCCCCCACAGTCACTTCGACAGTGTTAAAGCGACTTCAGCCACAGACCACATATGACATCACAGTTCTTCCTATTTACAAGATGGGAGAAGGAAAGCTTAGGCAAGGATCAGGAACAACAGCTTCTCGGTTTAAGTCTCCTAGAAACCTCAAAACATCTGACCCAACCATGTCAAGCTTCCGAGTGACTTGGGAGCCTGCCCCTGGGGAAGTGAAGGGTTATAAAGTCACATTCCACCCTACGGGGGATGACAGAAGACTGGGGGAGTTAGTGGTTGGACCCTATGACAACACAGTTGTTTTGGAGGAACTTAGGGCTGGTACCACCTATAAAGTAAATGTTTTTGGAATGTTTGATGGAGGAGAAAGCTCACCACTTGTTGGACAAGAAATGACAACCCTTTCCGACACAACTGTTATGCCAATTTTATCTTCTGGGATGGAGTGTCTCACCAGAGCTGAGGCAGACATTGTGTTGCTGGTGGATGGATCATGGAGCATCGGCCGGGCAAATTTTAGAACCGTGAGGAGTTTCATTTCTCGTATTGTGGAAGTCTTTGACATTGGCCCCAAAAGAGTACAAATTGCTCTTGCTCAGTATAGTGGGGATCCCAGAACAGAGTGGCAGTTAAATGCACACAGAGACAAGAAGAGCTTGTTGCAAGCTGTGGCAAACTTGCCGTACAAAGGAGGCAATACTCTCACAGGCATGGCTTTGAATTTCATTCGCCAACAGAACTTCAGGACCCAAGCTGGCATGAGACCTCGAGCTCGAAAAATTGGTGTGCTCATTACTGATGGAAAATCACAAGACGATGTTGAAGCACCTTCAAAGAAACTCAAGGATGAGGGAGTGGAGCTGTTTGCTATTGGTATTAAAAATGCTGATGAAGTCGAATTAAAGATGATTGCAACTGATCCTGATGATACCCATGCATACAATGTGGCAGATTTTGAGTCACTCTCCAGGATAGTGGATGATCTCACCATTAATTTGTGTAACAGTGTCAAAGGTCCAGGTGATTTGGAAGCACCTTCTAACTTAGTTATTTCTGAGCGAACCCATCGTTCTTTTAGAGTGAGCTGGACACCACCTTCTGACAGTGTGGATCGATATAAGGTGGAATACTATCCAGTTTCTGGAGGGAAACGTCAAGAATTTTATGTGAGTCGAATGGAAACTAGCACAGTGCTGAAAGATCTGAAACCTGAAACTGAATATGTTGTCAATGTGTATTCTGTGGTAGAAGATGAATATAGTGAGCCTCTGAAGGGGACAGAAAAAACCTTGCCAGTGCCTGTAGTCAGCCTGAATATTTATGATGTTGGCCCTACCACCATGCATGTGCAGTGGCAGCCTGTGGGAGGAGCTACTGGCTACATCTTGTCATACAAACCTGTTAAGGACACAGAGCCAACAAGACCCAAAGAGGTGCGTTTGGGGCCAACAGTGAATGACATGCAGCTGACTGACCTTGTTCCCAACACGGAGTATGCAGTCACAGTCCAGGCTGTCCTGCACGACCTCACTAGTGAACCTGTCACTGTTCGGGAAGTCACCTTGCCTTTACCCAGACCTCAGGATCTGAAACTCAGAGATGTGACTCACAGCACTATGAATGTCTTTTGGGAACCTGTGCCTGGAAAAGTGCGTAAATATATTGTTCGATACAAAACACCAGAAGAGGATGTCAAAGAGGTAGAGGTGGACAGATCAGAGACCAGCACTTCCCTCAAAGACCTCTTCTCACAGACCTTGTACACAGTCAGCGTTTCTGCAGTACATGACGAGGGGGAGTCTCCTCCAGTGACTGCTCAAGAAACTACCCGACCCGTGCCAGCCCCAACAAACTTAAAGATTACTGAAGTAACATCAGAGGGTTTCAGAGGGACTTGGGATCATGGAGCTTCAGATGTGTCTCTCTACAGAATAACTTGGGCACCTTTTGGAAGCTCAGATAAGATGGAGACCATCTTAAATGGAGATGAAAACACTTTGGTGTTCGAAAACCTGAACCCCAACACCATCTATGAAGTTTCCATTACTGCCATCTATCCTGATGAGTCAGAAAGTGATGACCTGATTGGCAGTGAGCGCACACTGCCTATCTTAACAACACAAGCTCCCAAAAGTGGCCCACGAAACCTTCAAGTGTACAATGCAACATCTAACAGCCTGACTGTTAAGTGGGATCCTGCTAGTGGTCGTGTGCAGAAATATAGGATCACTTATCAGCCTTCCACAGGGGAAGGCAATGAGCAAACGACCACAATAGGAGGACGGCAGAACAGTGTGGTCCTGCAGAAACTGAAGCCAGACACTCCTTACACTATCACCGTATCCTCTCTGTATCCTGATGGTGAAGGAGGTCGGATGACGGGAAGAGGCAAGACCAAACCTCTAAACACTGTAAGGAACCTGAGAGTGTATGACCCTTCTACCAGCACCTTGAATGTCCGCTGGGACCATGCAGAGGGAAATCCTCGTCAGTACAAGCTCTTCTATGCACCAGCAGCAGGTGGTCCAGAGGAACTGGTACCAATCCCCGGGAATACCAATTATGCCATTCTTAGGAATCTGCAGCCAGATACCTCATACACTGTGACTGTAGTTCCCGTTTATACTGAAGGTGATGGGGGACGCACATCAGATACTGGAAGGACATTGATGAGAGGACTGGCAAGAAATGTCCAAGTATACAATCCTACACCTAACAGCCTCGATGTTCGCTGGGACCCTGCTCCAGGACCTGTGCTGCAATATCGCGTTGTGTATTCTCCTGTGGATGGCACAAGACCCTCAGAATCTATAGTAGTGCCAGGAAACACGCGCATGGTGCATCTGGAGCGGCTGATTCCGGACACACTCTATTCCGTGAACCTTGTGGCTCTGTACTCGGATGGAGAGGGAAATCCCAGCCCTGCCCAGGGCCGAACGCTACCACGCAGTGGACCAAGGAACCTGAGAGTCTTTGGTGAAACAACCAATAGCCTCTCGGTAGCCTGGGATCATGCTGATGGGCCAGTTCAGCAGTACAGGATCATCTATTCTCCCACTGTTGGTGATCCAATTGATGAATATACCACAGTCCCAGGCAGAAGAAACAATGTAATACTGCAGCCCCTGCAACCTGACACTCCATATAAAATTACTGTTATTGCTGTTTATGAAGATGGAGATGGTGGCCATCTAACAGGAAATGGAAGAACTGTGGGACTCCTTCCTCCTCAGAACATACACATCTCTGACGAATGGTATACAAGATTCAGGGTGTCCTGGGATCCTTCACCTTCTCCAGTTCTTGGATATAAAATAGTATATAAGCCAGTGGGTTCCAATGAGCCCATGGAAGCCTTTGTTGGAGAAATGACATCATATACCTTACACAATCTCAATCCCAGCACCACCTACGATGTGAATGTTTATGCTCAATATGATTCTGGACTCAGTGTCCCCTTGACAGATCAAGGCACTACATTATATTTAAATGTAACAGATCTGAAAACTTACCAGATTGGGTGGGATACATTCTGTGTCAAATGGTCACCTCACCGGGCAGCCACCTCCTACAGGCTAAAACTAAGCCCTGCAGATGGAACAAGGGGACAAGAAATTACAGTGCGTGGATCAGAAACCAGTCACTGCTTCACTGGCCTTTCACCAGACACTGATTATGGTGTCACTGTTTTTGTGCAGACACCAAATCTCGAGGGACCAGGAGTCTCTGTTAAAGAACATACCACTGTGAAACCAACAGAAGCCCCTACAGAGCCACCCACACCTCCTCCCCCTCCCACCATTCCACCAGCCCGGGATGTATGCAAAGGGGCCAAGGCAGATATTGTGTTCTTGACTGATGCCTCCTGGAGCATTGGGGACGATAATTTTAACAAAGTTGTAAAATTCATCTTCAATACTGTGGGAGGCTTTGATGAAATCAGTCCTGCTGGGATTCAGGTTTCATTTGTGCAATACAGCGATGAGGTCAAGTCTGAGTTCAAGCTGAACACGTACAATGACAAGGCCCTAGCCCTTGGGGCCCTCCAGAATATTAGGTACAGAGGAGGAAACACAAGAACAGGCAAGGCCCTCACGTTTATCAAGGAGAAAGTCTTGACTTGGGAGAGCGGCATGAGGAAGAATGTCCCTAAGGTGTTGGTTGTGGTCACGGACGGTCGGTCCCAGGATGAGGTCAAGAAGGCGGCTTTGGTCATCCAGCAGTCAGGGTTCAGTGTCTTTGTAGTTGGTGTGGCTGATGTCGACTACAATGAGCTTGCCAACATTGCCAGCAAACCAAGTGAACGGCACGTGTTCATTGTGGACGACTTTGAATCTTTTGAGAAGATCGAAGACAATCTTATTACATTTGTTTGTGAAACTGCCACTTCAAGTTGTCCTCTCATTTATTTGGATGGCTACACCTCACCAGGTTTTAAAATGCTTGAAGCATACAACCTGACAGAAAAGAATTTTGCTTCTGTACAAGGAGTATCTTTGGAGTCAGGGTCTTTCCCCAGCTACTCAGCATACAGGATTCAGAAGAATGCGTTTGTGAATCAGCCTACAGCAGACCTACACCCAAATGGACTCCCTCCTTCATACACGATTATATTATTATTCAGACTTCTCCCAGAAACTCCCAGTGACCCTTTTGCAATTTGGCAAATCACAGACAGAGACTACAAACCACAAGTTGGAGTGATTGCAGATCCTTCTAGCAAGACGTTATCATTCTTTAACAAGGATACAAGAGGCGAGGTGCAAACTGTTACATTTGACACAGAAGAAGTAAAGACATTATTTTATGGAAGTTTTCACAAGGTTCATATTGTAGTGACCTCAAAAAGTGTTAAGATTTACATTGACTGCTATGAAATTATAGAAAAAGACATCAAGGAAGCTGGAAATATAACAACTGATGGTTATGAAATTCTTGGAAAACTCCTTAAAGGGGAAAGGAAATCAGCCGCATTCCAAATCCAGAGTTTTGACATTGTCTGCAGTCCAGTGTGGACCAGTAGAGACAGATGCTGTGATATTCCCTCTAGGAGAGATGAGGGAAAATGCCCTGCTTTTCCAAATTCTTGCACATGTACACAGGACAGCGTTGGACCTCCAGGACCTCCAGGCCCTGCAGGAGGACCTGGTGCTAAAGGTCCCAGAGGTGAAAGAGGTATCAGTGGGGCAATTGGGCCCCCTGGTCCTCGTGGAGACATAGGTCCTCCAGGCCCCCAGGGTCCTCCAGGCCCTCAGGGACCCAATGGACTCTCTATTCCGGGAGAGCAAGGTCGCCAAGGGATGAAAGGTGATGCTGGAGAGCCAGGACTTCCAGGCCGAACAGGAACCCCAGGATTACCTGGCCCACCAGGACCAATGGGACCTCCAGGAGACAGAGGCTTCACTGGAAAAGACGGTGCAATGGGACCCAGGGGCCCACCAGGGCCGCCGGGAAGCCCAGGCTCCCCAGGAGTCACAGGACCAAGTGGGAAGCCAGGAAAACCTGGAGATCATGGCAGACCAGGTCCATCTGGGTTGAAAGGAGAAAAAGGTGATAGGGGAGACATTGCTTCCCAGAACATGATGCGAGCAGTTGCAAGACAAGTCTGTGAACAATTGATAAGTGGTCAGATGAACAGATTCAATCAGATGCTGAATCAGATTCCAAATGATTACCAGTCCAGTCGCAACCAGCCAGGCCCGCCGGGTCCACCGGGACCTCCTGGTAGCGCAGGAGCCAGAGGAGAACCTGGGCCTGGGGGGCGGCCAGGCTTCCCGGGCACACCAGGGATGCAGGGACCCCCTGGGGAACGAGGTTTGCCAGGAGAGAAAGGTGAAAGGGGTACTGGATCTTCAGGACCTCGGGGGCTGCCTGGCCCCCCAGGTCCACAAGGAGAATCCAGAACAGGTCCACCAGGGTCCACAGGTTCAAGAGGTCCCCCTGGCCCCCCTGGCCGTCCTGGAAACTCAGGTATCCGAGGACCCCCAGGTCCTCCTGGATACTGTGATTCTTCTCAGTGTGCCAGCATCCCATACAACGGGCAAGGCTATCCAGAGCCTTACGTGCCCGAGGGCGGGGCCTACCTGCCTGAGCGCGAGCCCTTCATCGTGCCGGTGGAGCCCGAGCGGACAGCGGAATACGAGGACTACGGCGCAGACGAGCCTGCAGAGGAGCCTCCTGAGCCCCACCGGCGCTGGCGGCGCGCCCTGCCCCACGGACCCGGGCAGTGAACCAGAGATCACGCGCCGCGCCGCGAGGCTTGGGGGAGGTGTTGAAATTCTCATTTACAGGTCAGATAGAGCAGTGTACGTCTTTTCTGAGGTGTTTCTTCCAGCGTTGCTCATCCAGGAGTACCCTTTCTGATTGTAGAGAACCTTGTTTCTGCAGGAAGCCTAGCTCCAAGCACGCAGTCTGTAGACATTTTTGCCTTTGCCCTTGAAATGCTTGCAAAATACTTTGTTAACAAAAGCTGCAAAGAGAGAACATGCCGTGTGCCTTTAGTTAGCACAGCGGGCAGCCTCAGTGAAACTCTTAGGTTAAGCAGTTAAGTCCTGGAACCCAGAGCTGCTGTGTATTTCGAGCGGGCAGTTTATCTTTTGCTATACTTATTTTCAATTCAATTACACCACGATTCAAATAATTCCCCTCCTAAAACCAAAAAGGAGGGAAACGTCAACTCCATTGCAATTACTTATCTTCCTCTTCTATCTCTGTTATACGCCGGGGCATAGAATGCTCGTATACATCTCTTTAACAACCACAAACCTTAAGCCATGTAGATGAAGTTAGTGCATCAACGGGATACAGTTCCATATTGCCTTAAACCTCCTTGTTTTAGACACACTAACATTTATACCAAATTGCAGATTATTCTGCAGAGAGGGAATTGCATGTTTGTGTTGTATATTTAGTATGAACTTTTTTCAGAATATAATATTTCTTAGTTATCAAAAGTAGTTGGAAAACATTTGCAAGACTATGAACATAGAATTGCTGCTTTTATATTTTAACTGCAGATTGTGAATTTCACTGCCTTATATTATTTATTTCTGAAACAAAAGAGGCATTTTTCAATAAAACTACTGAAAATTTGA