Transcript asmbl_112788

Sequence
Transcript Sequence for observation asmbl_112788 of TGE0056946:
CCCTCCCTTCTCCCCGCCCCCCAGCGGGGCACTGCTACTACGGCGATCGCCACCTCACGCCGAAGGAATGCTCGAAGTATGCACACGTTCCCAAAAGTAGACCTCCTTCACCGCCGGAGGAGCATACATCACCCCGTGGCAGCCGTCCACCTTCTCAGGCGTTTCGTAACCGAGTAAACTGAGAGCTGGGAACAGCCCTCTATTAAGTAGCCCGCGGCGCGGAGTCTCTTTCCACTTGGCTAAGGCGAACCGCCCCAGACGCGTCCGCGCGCCGGCAGCTGCAGGCTCAGGCCATCTCCAGTCTTCCTGCCGCGCCCGCCTCTCCTCCTGGGATTCTCCTCCTCCTCCTGGACTTCCCCGCAGCTGCCCACGCCTCGGCGGCCGCCAGGTGCTCCTGGAGTGCAGCGCCTATCGCCGGGGCGTGTGGGGGCCACACCGAGCACCAGCTTCTCCGACGCCGGGAAGCCGCTGTCGCCGCCGCTACCTCTCCCTGTTGCCGCCGCCTCAGATCTCTTCATGCCGCTGTAAGCTCGGAGGCCAAGGATGCGGAGTAGGCTTCCCCCAGCGCTTGCCGCCCTGGGCGCGGCCCTGCTCCTGTCTTCCATTGAGGCAGAAGTTGACCCACCTTCAGACTTGAATTTTAAAATTATAGATGAAAATACTGTTCATATGTCATGGGCAAAACCAGTTGATCCAATTGTGGGTTACAGAATAACGGTGGACCCTACAACGGATGGGCCTACTAAAGAATTTACCCTTTCAGCTAGTACCACTGAAACTTTATTGTCAGAACTTGTACCTGAAACAGAGTATGTGGTGACAATAACTTCATATGATGAAGTAGAAGAAAGTGTACCAGTTATAGGACAACTAACAATTCAAACAGGTAGTTCGACAAAGCCAGTGGAGAAGAAACCTGGAAAAACCGAGATACAAAAATGCTCTGTCAGTGCCTGGACTGATTTGGTTTTCCTCGTGGATGGCTCTTGGAGTGTGGGAAGAAATAATTTCAAGTACATTTTAGACTTCATTGCTGCTCTTGTGTCTGCTTTTGACATTGGGGAAGAGAAGACAAGAGTTGGAGTTGTTCAATACAGCTCTGATACCAGGACTGAATTTAACTTAAATCAGTACTACCAAAGGGATGAACTTCTTGCTGCAATAAAAAAAATTCCATATAAAGGTGGCAACACAATGACAGGGGATGCCATTGATTATTTAGTTAAAAATACTTTCACGGAATCTGCTGGGGCAAGAGTTGGCTTTCCTAAAGTGGCAATTATTATTACGGATGGAAAATCCCAGGATGAAGTGGAAATTCCAGCAAGAGAGCTTCGTAATGTTGGAGTTGAAGTTTTCTCCTTGGGCATTAAAGCTGCAGATGCAAAAGAACTCAAACAAATTGCCTCCACACCTTCACTGAACCATGTTTTCAATGTGGCCAACTTTGATGCAATTGTGGATATTCAGAATGAGATCATCTCCCAGGTGTGCTCAGGTGTTGATGAACAACTTGGTGAATTGGTTAGTGGAGAAGAAGTTGTTGAGCCTCCTTCAAATTTGATTGCCATGGAAGTCTCTTCAAAATATGTTAAGCTAAATTGGAATCCATCTCCTAGTCCAGTGACTGGCTACAAAGTCATCCTCACACCAATGACTGCAGGAAGCCGACAGCACGCTCTGAGTGTGGGGCCTCAGACAACCACGCTCAGTGTTCGCGACCTCTCAGCAGACACAGAATACCAGATCAGTGTTTCCGCCATGAAGGGAATGACATCCAGTGAACCCATTTCAATAATGGAGAAGACTCAGCCAATGAAAGTTCAAGTGGAATGCTCACGTGGTGTGGATATAAAAGCCGATATTGTGTTTTTGGTTGATGGCTCCTATAGCATTGGGATTGCAAACTTTGTTAAAGTTAGAGCCTTTTTGGAAGTTCTTGTAAAAAGTTTTGAAATTTCACCAAATAGGGTCCAGATTAGTCTTGTGCAATACAGCCGGGATCCTCATACTGAGTTCACTTTGAAAAAATTCACCAAAGTTGAAGATATAATTGAAGCAATAAACACCTTCCCTTACAGAGGAGGATCTACAAATACTGGCAAAGCAATGACTTATGTCAGAGAGAAAATATTTGTGCCTAGCAAGGGATCAAGAAGCAATGTGCCAAAGGTCATGATTCTTATCACGGATGGGAAATCATCAGATGCTTTCAGAGATCCTGCGATAAAACTGAGGAATTCAGATGTTGAAATCTTTGCAGTTGGTGTGAAGGATGCCGTTCGCTCAGAATTGGAAGCTATTGCCTCTCCTCCTGCAGAGACCCATGTGTTCACAGTGGAAGATTTTGATGCTTTTCAGAGGATATCTTTTGAACTCACACAGTCTATCTGCCTTAGAATTGAGCAAGAATTGGCAGCTATAAAGAAGAAAGCTTACGTCCCTCCAAAGGATCTTAGTTTTTCAGAAGTGACTTCTTATGGTTTCAAAACCAACTGGTCTCCAGCTGGAGAAAATGTTTTTTCATATCACATCACCTACAAGGAAGCGGCTGGGGATGATGAGGTCACTGTGGTGGAGCCAGCATCGAGCACCAGTGTTGTTCTCAGCAGCCTGAAGCCAGAGACCTTGTATTTGGTCAATGTGACTGCGGAGTATGAGGATGGCTTCAGCATTCCCTTAGCTGGAGAGGAGACCACCGAAGAAGTAAAAGGAGCACCTCGAAACCTAAAGGTGACAGATGAGACTACAGATAGTTTCAAAATTACTTGGACTCAAGCTCCAGGGAGAGTTTTAAGATATCGAATTATATATAGACCAGTTGCTGGTGGAGAGAGCAGAGAAGTTACCACCCCACCCAATCAGAGGAGGAGAACACTGGAGAACTTGATTCCAGACACGAAATATGAAGTATCTGTAATTCCTGAATATTTCTCAGGACCTGGTACTCCATTAACTGGAAATGCAGCCACTGAAGAAGTTAGAGGGAATCCAAGAGACTTAAGAGTTTCTGACCCTACGACGTCTACTATGAAATTATCTTGGAGTGGGGCACCAGGAAAAGTGAAACAGTATCTCGTCACATATACCCCAGTGGCAGGGGGTGAAACTCAAGAGGTCACTGTGAGGGGAGATACAACCAATACGGTGCTGCAGGGATTGAAGGAAGGGACACAATACGCCTTATCTGTGACAGCCTTGTATGCGTCTGGGGCTGGAGACGCCCTCTTTGGTGAAGGAACAACACTTGAAGAACGTGGTTCTCCTCAAGATTTAGTTACTAAAGACATCACTGACACATCAATTGGGGCTTATTGGACATCTGCTCCAGGAATGGTTCGCGGTTACAGGGTCTCATGGAAATCACTTTATGATGATGTTGACACTGGAGAGAAAAATCTGCCTGAAGATGCAATTCATACGATGATAGAAAATCTGCAGCCAGAGACCAAATACAGAATTTCAGTATTTGCCACTTACAGCAGTGGAGAAGGAGAACCTTTGACTGGAGATGCCACAACTGAATTATCTCAAGATTCCAAAACCCTGAAAGTAGATGAAGAAACAGAAAACACAATGAGAGTTACATGGAAACCAGCACCAGGGAAAGTCGTCAACTACCGTGTTGTCTATCGCCCTCATGGGAGAGGGAAGCAAATGGTTGCTAAGGTGCCCCCCACAGTCACTTCGACAGTGTTAAAGCGACTTCAGCCACAGACCACATATGACATCACAGTTCTTCCTATTTACAAGATGGGAGAAGGAAAGCTTAGGCAAGGATCAGGAACAACAGCTTCTCGGTTTAAGTCTCCTAGAAACCTCAAAACATCTGACCCAACCATGTCAAGCTTCCGAGTGACTTGGGAGCCTGCCCCTGGGGAAGTGAAGGGTTATAAAGTCACATTCCACCCTACGGGGGATGACAGAAGACTGGGGGAGTTAGTGGTTGGACCCTATGACAACACAGTTGTTTTGGAGGAACTTAGGGCTGGTACCACCTATAAAGTAAATGTTTTTGGAATGTTTGATGGAGGAGAAAGCTCACCACTTGTTGGACAAGAAATGACAACCCTTTCCGACACAACTGTTATGCCAATTTTATCTTCTGGGATGGAGTGTCTCACCAGAGCTGAGGCAGACATTGTGTTGCTGGTGGATGGATCATGGAGCATCGGCCGGGCAAATTTTAGAACCGTGAGGAGTTTCATTTCTCGTATTGTGGAAGTCTTTGACATTGGCCCCAAAAGAGTACAAATTGCTCTTGCTCAGTATAGTGGGGATCCCAGAACAGAGTGGCAGTTAAATGCACACAGAGACAAGAAGAGCTTGTTGCAAGCTGTGGCAAACTTGCCGTACAAAGGAGGCAATACTCTCACAGGCATGGCTTTGAATTTCATTCGCCAACAGAACTTCAGGACCCAAGCTGGCATGAGACCTCGAGCTCGAAAAATTGGTGTGCTCATTACTGATGGAAAATCACAAGACGATGTTGAAGCACCTTCAAAGAAACTCAAGGATGAGGGAGTGGAGCTGTTTGCTATTGGTATTAAAAATGCTGATGAAGTCGAATTAAAGATGATTGCAACTGATCCTGATGATACCCATGCATACAATGTGGCAGATTTTGAGTCACTCTCCAGGATAGTGGATGATCTCACCATTAATTTGTGTAACAGTGTCAAAGGTCCAGGTGATTTGGAAGCACCTTCTAACTTAGTTATTTCTGAGCGAACCCATCGTTCTTTTAGAGTGAGCTGGACACCACCTTCTGACAGTGTGGATCGATATAAGGTGGAATACTATCCAGTTTCTGGAGGGAAACGTCAAGAATTTTATGTGAGTCGAATGGAAACTAGCACAGTGCTGAAAGATCTGAAACCTGAAACTGAATATGTTGTCAATGTGTATTCTGTGGTAGAAGATGAATATAGTGAGCCTCTGAAGGGGACAGAAAAAACCTTGCCAGTGCCTGTAGTCAGCCTGAATATTTATGATGTTGGCCCTACCACCATGCATGTGCAGTGGCAGCCTGTGGGAGGAGCTACTGGCTACATCTTGTCATACAAACCTGTTAAGGACACAGAGCCAACAAGACCCAAAGAGGTGCGTTTGGGGCCAACAGTGAATGACATGCAGCTGACTGACCTTGTTCCCAACACGGAGTATGCAGTCACAGTCCAGGCTGTCCTGCACGACCTCACTAGTGAACCTGTCACTGTTCGGGAAGTCACCTTGCCTTTACCCAGACCTCAGGATCTGAAACTCAGAGATGTGACTCACAGCACTATGAATGTCTTTTGGGAACCTGTGCCTGGAAAAGTGCGTAAATATATTGTTCGATACAAAACACCAGAAGAGGATGTCAAAGAGGTAGAGGTGGACAGATCAGAGACCAGCACTTCCCTCAAAGACCTCTTCTCACAGACCTTGTACACAGTCAGCGTTTCTGCAGTACATGACGAGGGGGAGTCTCCTCCAGTGACTGCTCAAGAAACTACCCGACCCGTGCCAGCCCCAACAAACTTAAAGATTACTGAAGTAACATCAGAGGGTTTCAGAGGGACTTGGGATCATGGAGCTTCAGATGTGTCTCTCTACAGAATAACTTGGGCACCTTTTGGAAGCTCAGATAAGATGGAGACCATCTTAAATGGAGATGAAAACACTTTGGTGTTCGAAAACCTGAACCCCAACACCATCTATGAAGTTTCCATTACTGCCATCTATCCTGATGAGTCAGAAAGTGATGACCTGATTGGCAGTGAGCGCACACTGCCTATCTTAACAACACAAGCTCCCAAAAGTGGCCCACGAAACCTTCAAGTGTACAATGCAACATCTAACAGCCTGACTGTTAAGTGGGATCCTGCTAGTGGTCGTGTGCAGAAATATAGGATCACTTATCAGCCTTCCACAGGGGAAGGCAATGAGCAAACGACCACAATAGGAGGACGGCAGAACAGTGTGGTCCTGCAGAAACTGAAGCCAGACACTCCTTACACTATCACCGTATCCTCTCTGTATCCTGATGGTGAAGGAGGTCGGATGACGGGAAGAGGCAAGACCAAACCTCTAAACACTGTAAGGAACCTGAGAGTGTATGACCCTTCTACCAGCACCTTGAATGTCCGCTGGGACCATGCAGAGGGAAATCCTCGTCAGTACAAGCTCTTCTATGCACCAGCAGCAGGTGGTCCAGAGGAACTGGTACCAATCCCCGGGAATACCAATTATGCCATTCTTAGGAATCTGCAGCCAGATACCTCATACACTGTGACTGTAGTTCCCGTTTATACTGAAGGTGATGGGGGACGCACATCAGATACTGGAAGGACATTGATGAGAGGACTGGCAAGAAATGTCCAAGTATACAATCCTACACCTAACAGCCTCGATGTTCGCTGGGACCCTGCTCCAGGACCTGTGCTGCAATATCGCGTTGTGTATTCTCCTGTGGATGGCACAAGACCCTCAGAATCTATAGTAGTGCCAGGAAACACGCGCATGGTGCATCTGGAGCGGCTGATTCCGGACACACTCTATTCCGTGAACCTTGTGGCTCTGTACTCGGATGGAGAGGGAAATCCCAGCCCTGCCCAGGGCCGAACGCTACCACGCAGTGGACCAAGGAACCTGAGAGTCTTTGGTGAAACAACCAATAGCCTCTCGGTAGCCTGGGATCATGCTGATGGGCCAGTTCAGCAGTACAGGATCATCTATTCTCCCACTGTTGGTGATCCAATTGATGAATATACCACAGTCCCAGGCAGAAGAAACAATGTAATACTGCAGCCCCTGCAACCTGACACTCCATATAAAATTACTGTTATTGCTGTTTATGAAGATGGAGATGGTGGCCATCTAACAGGAAATGGAAGAACTGTGGGACTCCTTCCTCCTCAGAACATACACATCTCTGACGAATGGTATACAAGATTCAGGGTGTCCTGGGATCCTTCACCTTCTCCAGTTCTTGGATATAAAATAGTATATAAGCCAGTGGGTTCCAATGAGCCCATGGAAGCCTTTGTTGGAGAAATGACATCATATACCTTACACAATCTCAATCCCAGCACCACCTACGATGTGAATGTTTATGCTCAATATGATTCTGGACTCAGTGTCCCCTTGACAGATCAAGGCACTACATTATATTTAAATGTAACAGATCTGAAAACTTACCAGATTGGGTGGGATACATTCTGTGTCAAATGGTCACCTCACCGGGCAGCCACCTCCTACAGGCTAAAACTAAGCCCTGCAGATGGAACAAGGGGACAAGAAATTACAGTGCGTGGATCAGAAACCAGTCACTGCTTCACTGGCCTTTCACCAGACACTGATTATGGTGTCACTGTTTTTGTGCAGACACCAAATCTCGAGGGACCAGGAGTCTCTGTTAAAGAACATACCACTGTGAAACCAACAGAAGCCCCTACAGAGCCACCCACACCTCCTCCCCCTCCCACCATTCCACCAGCCCGGGATGTATGCAAAGGGGCCAAGGCAGATATTGTGTTCTTGACTGATGCCTCCTGGAGCATTGGGGACGATAATTTTAACAAAGTTGTAAAATTCATCTTCAATACTGTGGGAGGCTTTGATGAAATCAGTCCTGCTGGGATTCAGGTTTCATTTGTGCAATACAGCGATGAGGTCAAGTCTGAGTTCAAGCTGAACACGTACAATGACAAGGCCCTAGCCCTTGGGGCCCTCCAGAATATTAGGTACAGAGGAGGAAACACAAGAACAGGCAAGGCCCTCACGTTTATCAAGGAGAAAGTCTTGACTTGGGAGAGCGGCATGAGGAAGAATGTCCCTAAGGTGTTGGTTGTGGTCACGGACGGTCGGTCCCAGGATGAGGTCAAGAAGGCGGCTTTGGTCATCCAGCAGTCAGGGTTCAGTGTCTTTGTAGTTGGTGTGGCTGATGTCGACTACAATGAGCTTGCCAACATTGCCAGCAAACCAAGTGAACGGCACGTGTTCATTGTGGACGACTTTGAATCTTTTGAGAAGATCGAAGACAATCTTATTACATTTGTTTGTGAAACTGCCACTTCAAGTTGTCCTCTCATTTATTTGGATGGCTACACCTCACCAGGTTTTAAAATGCTTGAAGCATACAACCTGACAGAAAAGAATTTTGCTTCTGTACAAGGAGTATCTTTGGAGTCAGGGTCTTTCCCCAGCTACTCAGCATACAGGATTCAGAAGAATGCGTTTGTGAATCAGCCTACAGCAGACCTACACCCAAATGGACTCCCTCCTTCATACACGATTATATTATTATTCAGACTTCTCCCAGAAACTCCCAGTGACCCTTTTGCAATTTGGCAAATCACAGACAGAGACTACAAACCACAAGTTGGAGTGATTGCAGATCCTTCTAGCAAGACGTTATCATTCTTTAACAAGGATACAAGAGGCGAGGTGCAAACTGTTACATTTGACACAGAAGAAGTAAAGACATTATTTTATGGAAGTTTTCACAAGGTTCATATTGTAGTGACCTCAAAAAGTGTTAAGATTTACATTGACTGCTATGAAATTATAGAAAAAGACATCAAGGAAGCTGGAAATATAACAACTGATGGTTATGAAATTCTTGGAAAACTCCTTAAAGGGGAAAGGAAATCAGCCGCATTCCAAATCCAGAGTTTTGACATTGTCTGCAGTCCAGTGTGGACCAGTAGAGACAGATGCTGTGATATTCCCTCTAGGAGAGATGAGGGAAAATGCCCTGCTTTTCCAAATTCTTGCACATGTACACAGGACAGCGTTGGACCTCCAGGACCTCCAGGCCCTGCAGGAGGACCTGGTGCTAAAGGTCCCAGAGGTGAAAGAGGTATCAGTGGGGCAATTGGGCCCCCTGGTCCTCGTGGAGACATAGGTCCTCCAGGCCCCCAGGGTCCTCCAGGCCCTCAGGGACCCAATGGACTCTCTATTCCGGGAGAGCAAGGTCGCCAAGGGATGAAAGGTGATGCTGGAGAGCCAGGACTTCCAGGCCGAACAGGAACCCCAGGATTACCTGGCCCACCAGGACCAATGGGACCTCCAGGAGACAGAGGCTTCACTGGAAAAGACGGTGCAATGGGACCCAGGGGCCCACCAGGGCCGCCGGGAAGCCCAGGCTCCCCAGGAGTCACAGGACCAAGTGGGAAGCCAGGAAAACCTGGAGATCATGGCAGACCAGGTCCATCTGGGTTGAAAGGAGAAAAAGGTGATAGGGGAGACATTGCTTCCCAGAACATGATGCGAGCAGTTGCAAGACAAGTCTGTGAACAATTGATAAGTGGTCAGATGAACAGATTCAATCAGATGCTGAATCAGATTCCAAATGATTACCAGTCCAGTCGCAACCAGCCAGGCCCGCCGGGTCCACCGGGACCTCCTGGTAGCGCAGGAGCCAGAGGAGAACCTGGGCCTGGGGGGCGGCCAGGCTTCCCGGGCACACCAGGGATGCAGGGACCCCCTGGGGAACGAGGTTTGCCAGGAGAGAAAGGTGAAAGGGGTACTGGATCTTCAGGACCTCGGGGGCTGCCTGGCCCCCCAGGTCCACAAGGAGAATCCAGAACAGGTCCACCAGGGTCCACAGGTTCAAGAGGTCCCCCTGGCCCCCCTGGCCGTCCTGGAAACTCAGGTATCCGAGGACCCCCAGGTCCTCCTGGATACTGTGATTCTTCTCAGTGTGCCAGCATCCCATACAACGGGCAAGGCTATCCAGAGCCTTACGTGCCCGAGGGCGGGGCCTACCTGCCTGAGCGCGAGCCCTTCATCGTGCCGGTGGAGCCCGAGCGGACAGCGGAATACGAGGACTACGGCGCAGACGAGCCTGCAGAGGAGCCTCCTGAGCCCCACCGGCGCTGGCGGCGCGCCCTGCCCCACGGACCCGGGCAGTGAACCAGAGATCACGCGCCGCGCCGCGAGGCTTGGGGGAGGTGTTGAAATTCTCATTTACAGGTCAGATAGAGCAGTGTACGTCTTTTCTGAGGTGTTTCTTCCAGCGTTGCTCATCCAGGAGTACCCTTTCTGATTGTAGAGAACCTTGTTTCTGCAGGAAGCCTAGCTCCAAGCACGCAGTCTGTAGACATTTTTGCCTTTGCCCTTGAAATGCTTGCAAAATACTTTGTTAACAAAAGCTGCAAAGAGAGAACATGCCGTGTGCCTTTAGTTAGCACAGCGGGCAGCCTCAGTGAAACTCTTAGGTTAAGCAGTTAAGTCCTGGAACCCAGAGCTGCTGTGTATTTCGAGCGGGCAGTTTATCTTTTGCTATACTTATTTTCAATTCAATTACACCACGATTCAAATAATTCCCCTCCTAAAACCAAAAAGGAGGGAAACGTCAACTCCATTGCAATTACTTATCTTCCTCTTCTATCTCTGTTATACGCCGGGGCATAGAATGCTCGTATACATCTCTTTAACAACCACAAACCTTAAGCCATGTAGATGAAGTTAGTGCATCAACGGGATACAGTTCCATATTGCCTTAAACCTCCTTGTTTTAGACACACTAACATTTATACCAAATTGCAGATTATTCTGCAGAGAGGGAATTGCATGTTTGTGTTGTATATTTAGTATGAACTTTTTTCAGAATATAATATTTCTTAGTTATCAAAAGTAGTTGGAAAACATTTGCAAGACTATGAACATAGAATTGCTGCTTTTATATTTTAACTGCAGATTGTGAATTTCACTGCCTTATATTATTTATTTCTGAAACAAAAGAGGCATTTTTCAATAAAACTACTGAAAATTTGACA