Transcript asmbl_112479

Sequence
Transcript Sequence for observation asmbl_112479 of TGE0002344:
TATTTGCATGAGAGGTCCTATATAAAAACGACTCCTGGTACCTTGCTCCCATTACTTCCCGTTTTCTCGATCTGCTGCTCGTCTCAGGCTCGTAGTTCGCCTTCAACATGCCGGAACCAGCGAAGTCCGCTCCCGCGCCCAAGAAGGGCTCGAAGAAAGCCGTGACTAAGGCGCAGAAGAAGGACGGCAAGAAGCGCAAGCGCAGCCGCAAGGAGAGCTACTCCGTATACGTGTACAAGGTGCTGAAGCAGGTCCACCCCGACACCGGCATCTCCTCTAAGGCCATGGGAATCATGAACTCCTTCGTCAACGACATCTTCGAACGCATCGCGGGTGAGGCTTCCCGCCTGGCGCATTACAACAAGCGCTCGACCATCACCTCCAGGGAGATCCAGACGGCCGTGCGCCTGCTGCTGCCCGGGGAGTTGGCCAAGCACGCCGTGTCCGAGGGCACCAAGGCCGTCACCAAGTACACCAGCGCTAAGTAAACTTGCCAAGGAGGGACTTTCTCTGGAATTTCCTGATATGACCAAGAAAGCTTCTTATCAAAAGAAGCACAATTGCCTTCGGTTACCTCATTATCTACTGCAGAAAAGAAGACGAGAATGCAACCATACCTAGATGGACTTTTCCACAAGCTAAAGCTGGCCTCTTGATCTCATTCAGATTCCAAAGAGAATCATTTACAAGTTAATTTCTGTCTCCTTGGTCCATTCCTTCTCTCTAATAATCATTTACTGTTCCTCAAAGAATTGTCTACATTACCCATCTCCTCTTTTGCCTCTGAGAAAGAGTATATAAGCTTCTGTACCCCACTGGGGGGTTGGGGTAATATTCTGTGGTCCTCAGCCCTGTACCTTAATAAATTTGTATGCCTTTTCTCTTATTAA