Transcript asmbl_112356

Sequence
Transcript Sequence for observation asmbl_112356 of TGE0056945:
CTGCGCAGCCCAGCCCGCCGGTCCACGCCGCGCACCGCTCCGAGGGCCAGCGCCACCCGCTCCGCAGCCGGCACCATGCGCGAGATCGTGCACATCCAGGCGGGCCAGTGCGGCAACCAGATCGGCGCCAAGTTTTGGGAGGTCATCAGCGATGAGCATGGGATCGACCCCACAGGCAGTTACCATGGAGACAGTGACTTGCAGCTGGAGAGAATCAACGTGTACTACAATGAGGCTGCTGGTAACAAATATGTACCTCGGGCCATCCTGGTGGATCTGGAGCCTGGCACCATGGACTCTGTCAGGTCTGGACCCTTCGGCCAGATCTTCAGACCAGACAACTTCGTGTTCGGCCAGAGTGGAGCCGGGAATAACTGGGCCAAGGGCCACTACACAGAGGGAGCCGAGCTGGTCGACTCGGTCCTGGATGTGGTGAGGAAGGAGTCAGAGAGCTGTGACTGTCTCCAGGGCTTCCAGCTGACCCACTCTCTGGGGGGCGGCACGGGGTCCGGGATGGGCACCCTGCTCATCAGCAAGATCCGGGAAGAGTACCCAGACCGCATCATGAACACCTTCAGCGTCATGCCCTCACCCAAGGTGTCAGACACGGTGGTGGAGCCCTACAACGCCACCCTCTCTGTCCACCAGCTGGTGGAAAACACAGATGAAACCTACTCCATTGATAACGAGGCCCTGTATGACATCTGCTTCCGCACCCTGAAGCTGACCACCCCCACCTACGGGGACCTCAACCACCTGGTGTCGGCCACCATGAGCGGGGTCACCACCTGCCTGCGCTTCCCGGGCCAGCTGAACGCAGACCTGCGCAAGCTGGCGGTGAACATGGTGCCCTTCCCTCGCCTGCACTTCTTCATGCCCGGCTTCGCGCCCCTGACCAGCCGGGGCAGCCAGCAGTACCGGGCGCTCACGGTGCCCGAGCTCACCCAGCAGATGTTCGACTCCAAGAACATGATGGCCGCCTGCGACCCGCGCCACGGCCGCTACCTGACGGTGGCTGCCATCTTCCGGGGCCGCATGTCCATGAAGGAGGTGGACGAGCAGATGCTCAACGTGCAGAACAAGAACAGCAGCTACTTCGTGGAGTGGATCCCCAACAACGTGAAGACGGCCGTGTGCGACATCCCGCCCCGCGGCCTGAAGATGTCGGCCACCTTCATCGGCAACAGCACGGCCATCCAGGAGCTGTTCAAGCGCATCTCCGAGCAGTTCACGGCCATGTTCCGGCGCAAGGCCTTCCTGCACTGGTACACGGGCGAGGGCATGGACGAGATGGAGTTCACCGAGGCCGAGAGCAACATGAACGACCTGGTGTCCGAGTACCAGCAGTACCAGGACGCCACGGCCGACGAACAAGGGGAGTTCGAGGAGGAGGAGGGCGAGGACGAGGCTTAAAAACTTCTCAGATCAATCGTGCATCCTTAGTGAACTTCTGTTGTCCTCAAGCATGGTCTTTCTACTTGTAAACTATGGTGCTCAGTTTTGCCTCTGTTAGAAATTCACACTGTTGATGTAATGATGTGGAACTCCTCTAAAAATTACAGTATTGTCTGTGAAGGTATCTATACTAATAAAAAAGCATGTGTAG