Transcript asmbl_11009

Sequence
Transcript Sequence for observation asmbl_11009 of TGE0056884:
GTTGGTGAGTTCCGGTATTTCAGGGCGTAGCAGGCGGAAGTAAGGGTGAGAGGAGGCTGCAACGCCGAGCGGAGGAGGCAGGAACCGGAGCGCGAGCAGTAGCTGGGTGGGCACCATGGCTGGGATCACCACCATCGAGGCGGTGAAGCGCAAGATCCAGGTTCTGCAGCAGCAGGCAGATGATGCAGAGGAGCGAGCTGAGCGCCTCCAGCGAGAAGTTGAGGGAGAAAGGCGGGCCCGGGAACAGGCTGAGGCTGAGGTGGCCTCCTTGAACCGTAGGATCCAGCTGGTTGAAGAAGAGCTGGACCGTGCTCAGGAGCGCCTGGCCACTGCCCTGCAAAAGCTGGAAGAAGCTGAAAAAGCTGCTGATGAGAGTGAGAGAGGTATGAAGGTTATTGAAAACCGGGCCTTAAAAGATGAAGAAAAGATGGAACTCCAGGAAATCCAACTCAAAGAAGCTAAGCACATTGCAGAAGAGGCAGATAGGAAGTATGAAGAGGTGGCTCGTAAGTTGGTGATCATTGAAGGAGACTTGGAACGCACAGAGGAACGAGCTGAGCTGGCAGAGTCGTGAGTATCTAGCTCCCCAAATCTTGTCATTACCAATTTATCCCTTCCCCTTTGGCTTGGGCACTAATATGAATAAATTAGCATTCCTTCAACCTTGTTAAACAGGGCCTAGGGAATGGGAGTCATCTATAGTGCTTTTTTAGGCCCAAGAATGGTTTTAGGCTTCCTTATTCTCCTGACTAGTGACAAGTGACAAAAGAGGCTTTCTTATTTTTTGTTGGTAGGGTTTACAAATTGAGAGCAAATAAGGACTAATACATGGTGAACAGTTAATTGGAAGATCCTACTGGGTCCTTCCACCTGGGGTGGAAGACATCAAAGTGGCTATCCTGATTTAA