Transcript asmbl_11007

Sequence
Transcript Sequence for observation asmbl_11007 of TGE0056940:
GTTGGTGAGTTCCGGTATTTCAGGGCGTAGCAGGCGGAAGTAAGGGTGAGAGGAGGCTGCAACGCCGAGCGGAGGAGGCAGGAACCGGAGCGCGAGCAGTAGCTGGGTGGGCACCATGGCTGGGATCACCACCATCGAGGCGGTGAAGCGCAAGATCCAGGTTCTGCAGCAGCAGGCAGATGATGCAGAGGAGCGAGCTGAGCGCCTCCAGCGAGAAGTTGAGGGAGAAAGGCGGGCCCGGGAACAGGCTGAGGCTGAGGTGGCCTCCTTGAACCGTAGGATCCAGCTGGTTGAAGAAGAGCTGGACCGTGCTCAGGAGCGCCTGGCCACTGCCCTGCAAAAGCTGGAAGAAGCTGAAAAAGCTGCTGATGAGAGTGAGAGAGGTATGAAGGTTATTGAAAACCGGGCCTTAAAAGATGAAGAAAAGATGGAACTCCAGGAAATCCAACTCAAAGAAGCTAAGCACATTGCAGAAGAGGCAGATAGGAAGTATGAAGAGGTGGCTCGTAAGTTGGTGATCATTGAAGGAGACTTGGAACGCACAGAGGAACGAGCTGAGCTGGCAGAGTCCCGTTGCCGAGAGATGGATGAGCAGATTAGACTGATGGACCAGAACCTGAAGTGTCTGAGTGCTGCTGAAGAAAAGGTACTAACCATTAAGCCCACAGCAAGGTTATATATGTGGTGTGGTTTTGTTTTGTTTTGTTTTTGTTTTGCAGCTGCCTCCCCTCCACTTGATTTTGTTGAGTGCTGTCTCATCTCTTCATGGAATGCTCCATTCTTTTCCACTTACTTGGCATCTTTCATCTCTTCTTTCCTAGTTGCTTCACTGCCTCTCCACAGGGTCTCCTTCCTTTGGGTGATTTGGGGGACTGTTTGGGTTGGGCATTTGTTCCCACCTCCACCCCAGGTAGCAGTTATGACTTGTTCCTGGTAGTGGATTTCTCTCAAGTGCTTTATTAGTATTCAAACATTTTTGAGCCCAGGAAGGTCTAGCTCCTGACACGTTCTATGGTAGAGGGAGGAGGGTTGATGCTTGCTCAGGTTACTTGGGAACATCTCTTCCCCAGTATGCCTTCCAACTCTCTCTACATATAGGTTCAATTCACGTCTATGTGTCTCTCTCCCTTTTTTTATTCTCTTCCTTTTCCCTTTTCCTCTCCTGTGGTATTTAAAATATTCACAGTAAGTGTTCTGAGCTGGAGGAGGAGCTGAAGAATGTCACCAACAACCTCAAGTCTCTTGAGGCTCAGGCGGAGAAGTACTCTCAAAAAGAAGATAAA