Transcript asmbl_105759

Sequence
Transcript Sequence for observation asmbl_105759 of TGE0056939:
GGAAACTGAGGAGGTTCTCCCGGCAAGCCCCTCGGGCTAGTGACATTCTAAGATTCCAAGAGCTAAGGAGCTAGAGGGGTGGGGTGGAGGAGGGAGGCGGGCGCGCCGGATTGGCCTCTGCGCGCCACGTGTCCGGCTCGGAGCCCACGGCTGTCCTCCCGGTCCGCCCCGCGCTGCGGTTGCTGCTGGGCTAACGGGCTCCGATCCAGCGAGCGCTGCGTCCTCGAGTCCCTGCGCCCGTGCGTCCGTCTGCGACCCGAGGCCTCCGCTGCGCGTGGATTCTGCTGCGAACCGGAGACCATGGCCAAACCAGCACAGGGTGCCAAGTACCGGGGCTCCATCCATGACTTCCCAGGCTTTGACCCCAACCAGGATGCCGAGGCTCTGTACACTGCCATGAAGGGCTTTGGCAGTGACAAGGAGGCCATACTGGACATAATCACCTCACGGAGCAACAGGCAGAGGCAGGAGGTCTGCCAGAGCTACAAGTCCCTCTACGGCAAGGACCTCATTGCTGATTTAAAGTATGAATTGACGGGCAAGTTTGAACGGTTGATTGTGGGCCTGATGAGGCCACCTGCCTATTGTGATGCCAAAGAAATTAAAGATGCCATCTCGGGCATTGGCACTGATGAGAAGTGCCTCATTGAGATCTTGGCTTCCCGGACCAATGAGCAGATGCACCAGCTGGTGGCAGCATACAAAGATGCCTACGAGCGGGACCTGGAGGCTGACATCATCGGCGACACCTCTGGCCACTTCCAGAAGATGCTTGTGGTCCTGCTCCAGGGAACCAGGGAGGAGGATGACGTAGTGAGCGAGGACCTGGTACAACAGGATGTCCAGGACCTATACGAGGCAGGGGAACTGAAATGGGGAACAGATGAAGCCCAGTTCATTTACATCTTGGGAAATCGCAGCAAGCAGCATCTTCGGTTGGTGTTCGATGAGTATCTGAAGACCACAGGGAAGCCGATTGAAGCCAGCATCCGAGGGGAGCTGTCTGGGGACTTTGAGAAGCTAATGCTGGCCGTAGTGAAGTGTATCCGGAGCACCCCGGAATATTTTGCTGAAAGGCTCTTCAAGGCTATGAAGGGCCTGGGGACTCGGGACAACACCCTGATCCGCATCATGGTCTCCCGTAGTGAGTTGGACATGCTCGACATTCGGGAGATCTTCCGGACCAAGTATGAGAAGTCCCTCTACAGCATGATCAAGAATGACACCTCTGGCGAGTACAAGAAGACTCTGCTGAAGCTGTCTGGGGGAGATGATGATGCTGCTGGCCAGTTCTTCCCGGAGGCAGCGCAGGTGGCCTATCAGATGTGGGAACTTAGTGCAGTGGCCCGAGTAGAGCTGAAGGGAACTGTGCGCCCAGCCAATGACTTCAACCCTGACGCAGATGCCAAAGCGCTGCGGAAAGCCATGAAGGGACTCGGGACTGACGAAGACACAATCATCGATATCATCACGCACCGCAGCAATGTCCAGCGGCAGCAGATCCGGCAGACCTTCAAGTCTCACTTTGGCCGGGACTTAATGACTGACCTGAAGTCTGAGATCTCTGGAGACCTGGCAAGGCTGATTCTGGGGCTCATGATGCCACCGGCCCATTACGATGCCAAGCAGTTGAAGAAGGCCATGGAGGGAGCCGGCACAGATGAAAAGGCTCTTATTGAAATCCTGGCCACTCGGACCAATGCTGAAATCCGGGCCATCAATGAGGCCTATAAGGAGGACTATCACAAGTCCCTGGAGGATGCTCTGAGCTCAGACACATCTGGCCACTTCAGGAGGATCCTCATTTCTCTGGCCACGGGGCATCGTGAGGAGGGAGGAGAAAACCTGGACCAGGCACGGGAAGATGCCCAGGAAATAGCAGACACACCTAGTG