Transcript asmbl_105711

Sequence
Transcript Sequence for observation asmbl_105711 of TGE0056938:
GGGAGATTTACTATTGTCTCTGGCAGCCGCCGCGGGAGCCCGGGAGGGGGGCGGAGGCGGGCGGAGGCGGCGGCGCGGCCAGCGCACCATTCACTCCACCTGATCTCGGGGCGCTGTGCGCTGAGGAAGGCGCGGGCGAGCCGGAGCAGAAGAAGGAGGGAGGGAGCCAGCCGCTGCAGCCACCACCGCCACCATGTCCTACCAAGGCAAGAAGAACATCCCGCGGATCACGAGTGACCGTCTCCTTATCAAGGGAGGCAGAATCGTCAATGATGATCAGTCCTTTTATGCTGATATTTACATGGAAGATGGCTTAATAAAACAAATTGGAGACAATCTGATTGTTCCTGGAGGAGTGAAGACCATTGAAGCCAATGGGAAGATGGTGATCCCTGGAGGCATCGATGTCCATACTCACTTCCAGATGCCATATAAGGGAATGACCACAGTAGATGACTTCTTCCAAGGGACAAAGGCGGCCTTAGCAGGTGGCACCACCATGATCATTGACCATGTGGTGCCTGAGCCTGAGTCCAGCCTGACTGAGGCCTATGAGAAATGGAGAGAGTGGGCTGATGGGAAGAGTTGCTGTGACTATGCCCTGCATGTGGACATCACCCACTGGAATGACAGCGTCAAGCAGGAAGTGCAGAACCTCATCAAGGACAAAGGGGTTAACTCCTTCATGGTTTATATGGCTTATAAGGATTTGTATCAAGTATCTAACACAGAGCTCTATGAGATCTTCACCTGCCTGGGAGAGCTGGGGGCCATTGCTCAAGTTCATGCTGAGAATGGGGATATCATTGCCCAGGAGCAAACCCGCATGTTGGAAATGGGGATAACTGGCCCAGAAGGCCATGTACTGAGCAGGCCAGAAGAGCTGGAAGCTGAGGCTGTGTTCCGTGCCATCACCATTGCCAGCCAAACCAATTGCCCTCTCTACGTCACAAAGGTCATGAGCAAGAGTGCAGCTGACCTCATCTCACAAGCCAGGAAAAAAGGAAATGTAGTCTTTGGTGAGCCCATCACTGCCAGCCTCGGCATAGATGGAACCCATTATTGGAGCAAGAACTGGGCCAAGGCGGCTGCATTTGTGACATCCCCACCCCTGAGCCCTGACCCAACTACTCCGGACTACATCAACTCCTTGCTGGCCAGCGGGGATCTGCAGCTATCTGGGAGTGCCCACTGCACCTTCAGCACTGCCCAGAAAGCAATTGGGAAGGACAACTTCACAGCCATTCCTGAGGGCACCAATGGTGTGGAGGAGCGGATGTCTGTCATCTGGGACAAGGCTGTGGCCACAGGGAAAATGGACGAAAACCAGTTCGTGGCTGTGACAAGCACAAACGCTGCCAAGATCTTCAACCTGTATCCCCGCAAGGGAAGAATATCTGTGGGTTCTGACAGCGACCTCGTCATCTGGGATCCAGATGCTGTGAAGATCGTCTCTGCCAAGAACCACCAGTCTGCGGCAGAGTACAACATCTTTGAAGGGATGGAGCTGCGCGGGGCTCCTCTGGTTGTCATCTGCCAGGGCAAGATCATGCTGGAAGATGGCAACCTGCACGTGACCCAGGGGGCTGGCCGCTTCATACCCTGCAGCCCGTTCTCCGACTATGTCTACAAGCGCATTAAAGCACGGAGGAAGATGGCAGACCTGCATGCCGTCCCAAGGGGCATGTACGATGGGCCTGTGTTTGACCTGACCACCACCCCCAAAGGTGGCACCCCCGCAGGCTCTGCTCGGGGCTCTCCTACTCGGCCGAACCCACCTGTGAGGAATCTTCATCAGTCGGGATTTAGCCTGTCAGGCACCCAAGTGGATGAGGGGGTTCGCTCAGCCAGCAAGCGCATCGTGGCGCCCCCAGGCGGCCGTTCTAATATCACATCTCTGAGTTAAGCAAGCCTTCCTCAAAGAGAGGGGCAGAAGCAAGAAGAGATTGTTTTGAAGCCAAAATGGTACACCGATATTTAAGAAGGAAAGCGAATCCAAACGGTTGTGATCTAAAGAATCAATAAGCCTCAAGCCTTATGTTTCTCCAATGTTACGCTCGCTTGCCTAGCTTTACGAATATTGCTTTGTTTTCTGTTTATGCATAGCCTTGATTTGTTTGACTCCCCTCCCCCCATTTACATGCATGCAATCAGACAGGCCACTAAGGTAAAAGAGTCTGCTCTATCATAGTGTTGAGAGCGTGTGTAGTGCTGCATCTTATGACAAGGGGACAGACAAGCTGGGACGTCAGGGAAATGAACAAAAGGGACGCAGGTTATTTGGGGTGAGTGGGTGGTGGGAGCCTGGAGCAAGGTGGAGGGTGCAGAGGGGCTGGGGTAGGGCATGTAGGAGGGAGGTGGGTGGGTCAGGTGAGTGGAAGGGGTGTTGTATATTGTGTTGATGACGTACGTTATTTCCATGGAAGATAGCCGCTGTGGCAGCTGTCACATCACCACAGCTCCCTAGGGTCTGCCGAGAAGGCAGGCAGTCTTTGGGTTCTGTTCTTTGTCACGTCCCCTACAAGTAAATTTTGTTTCTTTGAACGTTTATTAAAATGCCAAGACCCAACCATTTCTTCCACCTGCTTGATTGTGCCAGTGTTTGCTCAGGCCTCTTTCTTAGTGTTGCTTTCAAATCCTTCTCTTTCCTGGGTTGGGAAGGCCAGGCAGGGACAGAGCAAATGACACTTCTCTTCCTCTTGCCCTCCCTGCCTCTTTGGTGCTCTTAAAAGCCAGCAGCTGAGAACATAGCACAGGCCCACGTGGTGAGGGCACCCACAGCTTAAAGACGCTTCCTTCTAAACACGGCGAGGTCACCTCTCACTCTTCTGTCTTTGCAAACCGAGAAGAGTGGCATGCTTCTGGCATCCCAAGTCAGGATTTTAGCTCAGATGAGGCAGAATGAAGGGCCTCTCTTACAGGCAGTTTGTGTTTGATTCTCTCGATCCTGGCACATCCATGATAAATAGGAGTTTTTGAAAGTTGGTTTTATTAGGTGTTCCCTAATTTTTACCGTAATAGGTCATCTCAGCTTATATGAAAGTCAAGTGGGGAACTGGGAAAGCCAAAGTCAGTCTTGAGCAGAGGGAGCACATTTTGTGGACCTGGTTCCACCTTTCCATTCCAAACCACCTGTTTCCCCTTCCATTAGCAGAAACTCTGGGGGAACTTTGTGTCTCAGTCCTAGAATCTCCCCAAGTGAGTGGAAGTGACATGATGCAGTCTTCCTCATGGGGCACCTGAAAGAAATTAGTGTGGGTGCTTCGATCTACCTTGTCTGTCAGAGTTGAATATCTCTTTCCCTATCATGCTGCTTCTGAAAATTCAGTTTTGGAGCAAGTCCTGTGAGCAAGATAAGAATCTATAGAACCAAGATGCTCATTTTCAGAAGAAATATGTTCAACCTGGGATCAGACTTCCATGCTCTGGGGAATCCAAGTGGTAGCACCTGTAACCCTGTGTACTAAGTGCTTTGAAGAGAAGAGCAGGCCTCAGACACCTTTTAATTGCTTAGGAGAAACCATTGTCTCTGACTGCAGGTTTGAATAAGTTGAAGACCAGAGAAAAGTACACACTGGGCTACAAAGGAATTTGGAGATAGCCAAGGAACAGGATTTCCCCTAGCAAGCTACCTTCTGTTCAAATCATGAAAAAAGACTATTTCCCCTTAGAATAGGGAAGCTTGCTATTTTAAAGCTCTTGTAGTGCTTTTCTTTTAAGGGAGATGTAGTAAAAGGGAAAATGTAGCTCTTAGTTTACACTTCAAAGATGTGGGGGTCTTTCAGAGAACTAAGAATAACAGTTTTATGTGCAGAGAGAGTTTGCCAGATCTGAAGCATATACCTCATTGACTAGGCTGTTACTTTGGGATAGGTTGCAGTACCAGCCACAGCCAGCAGATAGAGGAAAAGACACACATAAACTCGCTTCTGAGCGTCCACTTCTGCACTCTCTGCTCTGCTGTTACTCAGCCCCTGAGTCTGACTCATCTCTGCACAACCTCTCTGTGCCATGAAGATAAGTCTTCCATGGCCAAATCGGTCATCCGCACTGCCCTTGGGACTTCCGAAGTGAACCATTCCACCAGAACCTTTGATTCTGCACAAGATTTCCTTGCTCTGGGAACAACCCCCAAATGCCCTTGGGAGGAACAACATGAGCTCAGGAAGCCTCTCTTTCTTCACTTACCATTACTAACTCTCCAAGCATAGAAATCCCTGGGAATTGCGAGAATAACTCCCACTATTTTAAAATTTATATTCAGATTTGTTTCGTTTCATAAGACACATCAAACAGGCCTATACAAAAGGTTTAGGAAAAGAAAACAATGGTGAGTCCCGGCCCTCTTCGAATTCACTGGCACCTCATGCAAGTGTAGGAAGGCACGCTGGATCGTCTATCTGATTCCAAAGCTGTCCTTTGCCATCTCATCCCTTGGCCTGCCCCCCAACCCTGAGGATGCCCCTGCCATCCCCCCAACCTCCTCATATTGCCTCTGAACCCAGATGGCAATCCATCCCGGTTCTCTCTGAGGGCCACGGGCTTGGGTAGTGGAAAGGGTGTTTGGGAAATTGTTAAATCAGTTACCCGTAGTAGAGCTATTTCTTGTACTTCTAAGTTTTCTAGAAGTGGAAGGATTGTAGTCATCCTGAAAATGGGTTTACTTCAAAATCCCTCAGCCTTGTTCTTCACGACTGTCTATACTGAGAGTGTCATGTTTCCACAAAGGGCTGACACCTGAGCCTGGATTTTCACTCATCCCTGAGAAGCCCTTTCCAGTAGGGTGGGCAATTCCCAACTTCCTTGCCACAAGCTTCCCAGGCTTTCTCCCCTGGAAAACTCCAGCTTGAGTCCCAGATACACTCATGGGCTGCCCTGGGCAGCCAGCATTCATTGTAAGTTCCCTCTTTGAAAACTGGTGTGTGGGTGTTCAGTTCTGTGTCTGGTGGGTATGGACAGACAGTAATCTCCTGTGATCTGTGCTAGCTGTGAGGCAGCTCTGGAACGTGAAGAGCTGTTTGGTTTGAACCGTGAACAAAACTGTGTTTTGAGTTTAGCTGACATTAAAGAAAAAAGTTCATCACGTGACTGTTAATGTAAACCTGGTTATTAAAATAACTATGAAATTACC