Transcript asmbl_105710

Sequence
Transcript Sequence for observation asmbl_105710 of TGE0056937:
CTGGGTTTTTGTGCACGAGGGACGTCAGAAAGCTTTGTGTTTGTGAGGCAAACTAGGGAGTTAGTGTGGGTGAAGCAGTCAAGTGCTGGAGTGTGAACATTTCTAAGACGTCTAAATTGCGCGAAAGTGTGTGAGGCAAGGCTGTTGCGCGAGCGGGCAGTGTGCGCCTGTGTGTGCGTGTGCGCGCGCGCCAAGTTTGGTTTGTGATTGTGATGGGCACCGACGCTGCGTCAGCCCGGGAGGCCACGTTAGGGTTGGGGGTGCGTGAGGAGGTGCGGCCGGGCGAGAGGTCCAGCGAGTGAGCCAAGCGCGGCGCTACTCTGGGCCCCTGCTCCGCGCGCTAGCTGGCTGTGTGGCTCGCTGGCTCGCTAGGGACAAGCAGGAATCGGAGCAGCACTGCCGCCTCTGGCGCGAAGGCTCAGGCGCCTCCTCCCGCCACAGTCACTGTGGCTCGGCGCACGCTGCCGGCGGCTGCCCTTTCCGCCTCTGGGGAAGAAAAACCCGCGGGCCGCTTTCGTGCTTGAACCATGGCCTCGGGCCGGAGGGGCTGGGACAGCTCCCACGAAGACGATCTGCCCGTGTACCTGGCCAGGCCGGGCACCACGGACCAGGTCCCGCGGCAGAAATACGGCGGCATGTTCTGCAACGTGGAGGGCGCCTTCGAGAGCAAGACGCTGGATTTCGATGCCCTCAGCGTGGGGCAGCGGGGCGCGAAGACTCCTCGGAGCGGCCAGGGCAGCGACCGAGGATCGGGGAGTCGGCCCGGGATCGAGGGGGACACCCCGCGCAGGGGCCAAGGCCGGGAAGAGAGCAGGGAGCCCGCGCCCGCCTCCCCCGCCCCCGCCGGGGTAGAGATCCGGAGCGCCACCGGCAAAGAGGTGTTGCAGAACCTCGGCCCCAAGGACAAGAGTGACCGTCTCCTTATCAAGGGAGGCAGAATCGTCAATGATGATCAGTCCTTTTATGCTGATATTTACATGGAAGATGGCTTAATAAAACAAATTGGAGACAATCTGATTGTTCCTGGAGGAGTGAAGACCATTGAAGCCAATGGGAAGATGGTGATCCCTGGAGGCATCGATGTCCATACTCACTTCCAGATGCCATATAAGGGAATGACCACAGTAGATGACTTCTTCCAAGGGACAAAGGCGGCCTTAGCAGGTGGCACCACCATGATCATTGACCATGTGGTGCCTGAGCCTGAGTCCAGCCTGACTGAGGCCTATGAGAAATGGAGAGAGTGGGCTGATGGGAAGAGTTGCTGTGACTATGCCCTGCATGTGGACATCACCCACTGGAATGACAGCGTCAAGCAGGAAGTGCAGAACCTCATCAAGGACAAAGGGGTTAACTCCTTCATGGTTTATATGGCTTATAAGGATTTGTATCAAGTATCTAACACAGAGCTCTATGAGATCTTCACCTGCCTGGGAGAGCTGGGGGCCATTGCTCAAGTTCATGCTGAGAATGGGGATATCATTGCCCAGGAGCAAACCCGCATGTTGGAAATGGGGATAACTGGCCCAGAAGGCCATGTACTGAGCAGGCCAGAAGAGCTGGAAGCTGAGGCTGTGTTCCGTGCCATCACCATTGCCAGCCAAACCAATTGCCCTCTCTACGTCACAAAGGTCATGAGCAAGAGTGCAGCTGACCTCATCTCACAAGCCAGGAAAAAAGGAAATGTAGTCTTTGGTGAGCCCATCACTGCCAGCCTCGGCATAGATGGAACCCATTATTGGAGCAAGAACTGGGCCAAGGCGGCTGCATTTGTGACATCCCCACCCCTGAGCCCTGACCCAACTACTCCGGACTACATCAACTCCTTGCTGGCCAGCGGGGATCTGCAGCTATCTGGGAGTGCCCACTGCACCTTCAGCACTGCCCAGAAAGCAATTGGGAAGGACAACTTCACAGCCATTCCTGAGGGCACCAATGGTGTGGAGGAGCGGATGTCTGTCATCTGGGACAAGGCTGTGGCCACAGGGAAAATGGACGAAAACCAGTTCGTGGCTGTGACAAGCACAAACGCTGCCAAGATCTTCAACCTGTATCCCCGCAAGGGAAGAATATCTGTGGGTTCTGACAGCGACCTCGTCATCTGGGATCCAGATGCTGTGAAGATCGTCTCTGCCAAGAACCACCAGTCTGTAAGGCCCGCTCTGGTGGGAGTGGAGTAGAATGGAGAATGCATGCAAGGAACTTGGTCAGGAGAAATGTGTTTATGTGGTGTGCCAGGGTAGTTAGACTAGGACGGGTTGCAATAATAATCCATCCCCTAAATCTCAGTGGCTCAAAACCTCAACTGTGTTTCTCCTGCTTTCCAAAGCAGATGGGCTCTGCCCATTCCAGTCACTCAGGGACAGAGGCCAATAGAGGCTTCCTCTCTACATATGTTTTCATGATTGCTGAGACAGGGGAACATGACCTGGTGAATGGTCTACTGGCTCTGAAAGCTTCCCCTAGATGTGGTGTACGTCACTGCCTCTCACATGGCACTGGTCTTAGCCAGTCCTGTGGCTATACCTAACTTCCGGAAGTCAGGGCGTGCAATGATCCTTTGTGCCTGGAAAGGGAAAGAATAGGAAATAACTGGTAAACAGCAGTGATGACTTCTTCACGATGAGTTTCACATGGAGGATGATAATTAAAGTGCAGTACCTAACAGAAACGGGCTCGACACTGTTGTTAAAAATAGTTAATATTTTTAAGCACTTATGTTTCAGGCACTGTGCTTTGAATTCACTGGATTTCCATAGTAGTCTTCTACAGGTAGGGACTATTATCCTCCGTTTTATAGATTAAAAATTGGAGGTACAGAAAAATTAAATAATTTGTGCAGCAAGCGAATGGTGAAGCTAGCATTGAAACCCAGACAAGCTGACTCTAAACTGATGTTCTTAATTATTGGCAGTACAGTAATGCCTCTTGCTGATTGAGTAAATGAAGGAGGTAGGGAGAAATCCCATTTTTGGTGGCAATGGCCTTTGCTTAAATATTGTGTCATCTCATGTTATTTAATTTGGAGCTAGAGGGACCTAAAGGCCACATAACCTCTCTGCCCACCTGCTCAATACAAGACAGTGATGTACAGCATCCTGGATAGTTATCCAGCTTCTCTTTGAACACTACCCAAGACAAAAGTTGACTTCCACTTGAGGACCTTATTAAAGACCGGACACTTCTTTTTGCTAGGAAGTTTAGTCTTGTCTTAGTAAATCTGTCTCCGGTGCCTTCTACCCACTGGATGCTTGCAGATGCATGGTGAGCTTTTCCTGGCTTACCTGGTGAATCAGCAGCAAATGACACTGAAGGTCTCAAGGAGAGAAGGTACGTTCCTCTTTCTCTACCCTTACTGTGGCTTTGCTTCTCACCCCTGCCTCTAGGCGGCAGAGTACAACATCTTTGAAGGGATGGAGCTGCGCGGGGCTCCTCTGGTTGTCATCTGCCAGGGCAAGATCATGCTGGAAGATGGCAACCTGCACGTGACCCAGGGGGCTGGCCGCTTCATACCCTGCAGCCCGTTCTCCGACTATGTCTACAAGCGCATTAAAGCACGGAGGAAGATGGCAGACCTGCATGCCGTCCCAAGGGGCATGTACGATGGGCCTGTGTTTGACCTGACCACCACCCCCAAAGGTGGCACCCCCGCAGGCTCTGCTCGGGGCTCTCCTACTCGGCCGAACCCACCTGTGAGGAATCTTCATCAGTCGGGATTTAGCCTGTCAGGCACCCAAGTGGATGAGGGGGTTCGCTCAGCCAGCAAGCGCATCGTGGCGCCCCCAGGCGGCCGTTCTAATATCACATCTCTGAGTTAAGCAAGCCTTCCTCAAAGAGAGGGGCAGAAGCAAGAAGAGATTGTTTTGAAGCCAAAATGGTACACCGATATTTAAGAAGGAAAGCGAATCCAAACGGTTGTGATCTAAAGAATCAATAAGCCTCAAGCCTTATGTTTCTCCAATGTTACGCTCGCTTGCCTAGCTTTACGAATATTGCTTTGTTTTCTGTTTATGCATAGCCTTGATTTGTTTGACTCCCCTCCCCCCATTTACATGCATGCAATCAGACAGGCCACTAAGGTAAAAGAGTCTGCTCTATCATAGTGTTGAGAGCGTGTGTAGTGCTGCATCTTATGACAAGGGGACAGACAAGCTGGGACGTCAGGGAAATGAACAAAAGGGACGCAGGTTATTTGGGGTGAGTGGGTGGTGGGAGCCTGGAGCAAGGTGGAGGGTGCAGAGGGGCTGGGGTAGGGCATGTAGGAGGGAGGTGGGTGGGTCAGGTGAGTGGAAGGGGTGTTGTATATTGTGTTGATGACGTACGTTATTTCCATGGAAGATAGCCGCTGTGGCAGCTGTCACATCACCACAGCTCCCTAGGGTCTGCCGAGAAGGCAGGCAGTCTTTGGGTTCTGTTCTTTGTCACGTCCCCTACAAGTAAATTTTGTTTCTTTGAACGTTTATTAAAATGCCAAGACCCAACCATTTCTTCCACCTGCTTGATTGTGCCAGTGTTTGCTCAGGCCTCTTTCTTAGTGTTGCTTTCAAATCCTTCTCTTTCCTGGGTTGGGAAGGCCAGGCAGGGACAGAGCAAATGACACTTCTCTTCCTCTTGCCCTCCCTGCCTCTTTGGTGCTCTTAAAAGCCAGCAGCTGAGAACATAGCACAGGCCCACGTGGTGAGGGCACCCACAGCTTAAAGACGCTTCCTTCTAAACACGGCGAGGTCACCTCTCACTCTTCTGTCTTTGCAAACCGAGAAGAGTGGCATGCTTCTGGCATCCCAAGTCAGGATTTTAGCTCAGATGAGGCAGAATGAAGGGCCTCTCTTACAGGCAGTTTGTGTTTGATTCTCTCGATCCTGGCACATCCATGATAAATAGGAGTTTTTGAAAGTTGGTTTTATTAGGTGTTCCCTAATTTTTACCGTAATAGGTCATCTCAGCTTATATGAAAGTCAAGTGGGGAACTGGGAAAGCCAAAGTCAGTCTTGAGCAGAGGGAGCACATTTTGTGGACCTGGTTCCACCTTTCCATTCCAAACCACCTGTTTCCCCTTCCATTAGCAGAAACTCTGGGGGAACTTTGTGTCTCAGTCCTAGAATCTCCCCAAGTGAGTGGAAGTGACATGATGCAGTCTTCCTCATGGGGCACCTGAAAGAAATTAGTGTGGGTGCTTCGATCTACCTTGTCTGTCAGAGTTGAATATCTCTTTCCCTATCATGCTGCTTCTGAAAATTCAGTTTTGGAGCAAGTCCTGTGAGCAAGATAAGAATCTATAGAACCAAGATGCTCATTTTCAGAAGAAATATGTTCAACCTGGGATCAGACTTCCATGCTCTGGGGAATCCAAGTGGTAGCACCTGTAACCCTGTGTACTAAGTGCTTTGAAGAGAAGAGCAGGCCTCAGACACCTTTTAATTGCTTAGGAGAAACCATTGTCTCTGACTGCAGGTTTGAATAAGTTGAAGACCAGAGAAAAGTACACACTGGGCTACAAAGGAATTTGGAGATAGCCAAGGAACAGGATTTCCCCTAGCAAGCTACCTTCTGTTCAAATCATGAAAAAAGACTATTTCCCCTTAGAATAGGGAAGCTTGCTATTTTAAAGCTCTTGTAGTGCTTTTCTTTTAAGGGAGATGTAGTAAAAGGGAAAATGTAGCTCTTAGTTTACACTTCAAAGATGTGGGGGTCTTTCAGAGAACTAAGAATAACAGTTTTATGTGCAGAGAGAGTTTGCCAGATCTGAAGCATATACCTCATTGACTAGGCTGTTACTTTGGGATAGGTTGCAGTACCAGCCACAGCCAGCAGATAGAGGAAAAGACACACATAAACTCGCTTCTGAGCGTCCACTTCTGCACTCTCTGCTCTGCTGTTACTCAGCCCCTGAGTCTGACTCATCTCTGCACAACCTCTCTGTGCCATGAAGATAAGTCTTCCATGGCCAAATCGGTCATCCGCACTGCCCTTGGGACTTCCGAAGTGAACCATTCCACCAGAACCTTTGATTCTGCACAAGATTTCCTTGCTCTGGGAACAACCCCCAAATGCCCTTGGGAGGAACAACATGAGCTCAGGAAGCCTCTCTTTCTTCACTTACCATTACTAACTCTCCAAGCATAGAAATCCCTGGGAATTGCGAGAATAACTCCCACTATTTTAAAATTTATATTCAGATTTGTTTCGTTTCATAAGACACATCAAACAGGCCTATACAAAAGGTTTAGGAAAAGAAAACAATGGTGAGTCCCGGCCCTCTTCGAATTCACTGGCACCTCATGCAAGTGTAGGAAGGCACGCTGGATCGTCTATCTGATTCCAAAGCTGTCCTTTGCCATCTCATCCCTTGGCCTGCCCCCCAACCCTGAGGATGCCCCTGCCATCCCCCCAACCTCCTCATATTGCCTCTGAACCCAGATGGCAATCCATCCCGGTTCTCTCTGAGGGCCACGGGCTTGGGTAGTGGAAAGGGTGTTTGGGAAATTGTTAAATCAGTTACCCGTAGTAGAGCTATTTCTTGTACTTCTAAGTTTTCTAGAAGTGGAAGGATTGTAGTCATCCTGAAAATGGGTTTACTTCAAAATCCCTCAGCCTTGTTCTTCACGACTGTCTATACTGAGAGTGTCATGTTTCCACAAAGGGCTGACACCTGAGCCTGGATTTTCACTCATCCCTGAGAAGCCCTTTCCAGTAGGGTGGGCAATTCCCAACTTCCTTGCCACAAGCTTCCCAGGCTTTCTCCCCTGGAAAACTCCAGCTTGAGTCCCAGATACACTCATGGGCTGCCCTGGGCAGCCAGCATTCATTGTAAGTTCCCTCTTTGAAAACTGGTGTGTGGGTGTTCAGTTCTGTGTCTGGTGGGTATGGACAGACAGTAATCTCCTGTGATCTGTGCTAGCTGTGAGGCAGCTCTGGAACGTGAAGAGCTGTTTGGTTTGAACCGTGAACAAAACTGTGTTTTGAGTTTAGCTGACATTAAAGAAAAAAGTTCATCACGTGACTGTTAATGTAAACCTGGTTATTAAAATAACTATGAAATTACC