Transcript asmbl_25627

Sequence
Transcript Sequence for observation asmbl_25627 of TGE0000870:
TGACTTTGATTCTTCGGAGGTGCTTCAGGGACTGGACTTTTTTGGAAACAAGAAGTCTGTCCCAGGTGTGTGTGGAGCATCACAAACACATCAGAAGCCCCAAAATGGAGAGAAAAAAGAAGAGAGCCTAACTGAAAGGAAGAGGGAGCAGAGCAAGAAAAAAAGGAAGACGATGACTTCAGAAATTGCTTCCCAAGAAGAAGGTGCTACTATACAGTGGATGTCATCTGTAGAAGCAAAGATTGAAGACAAAAAAGTTCAGAGAGAAAGTAAACTAACTTCCGGAAAGTTGGAGAATCTCAGAAAAGAAAAGATAAACTTCTTGCGGAATAAACACAAAATTCACGTCCAAGGAACCGATCTTCCTGACCCAATTGCTACATTTCAGCAACTTGACCAGGAATATAAAATCAATTCTCGACTACTTCAGAACATTCTAGATGCAGGTTTCCAAATGCCTACGCCAATCCAAATGCAAGCCATCCCAGTTATGCTGCATGGTCGGGAACTTCTGGCTTCTGCTCCAACTGGATCTGGAAAAACATTAGCTTTTAGCATTCCTATTTTAATGCAGCTGAAACAACCCGCAAATAAAGGCTTCAGAGCCCTGATTATATCACCAACACGAGAACTTGCCAGCCAGATTCACAGAGAGTTAATAAAAATTTCTGAGGGAACAGGATTCAGAATACACATGATCCACAAAGCAGCAGTGGCAGCCAAGAAATTTGGACCTAAATCATCTAAAAAGTTTGATATTCTTGTGACTACTCCAAATCGACTAATCTATTTATTAAAGCAAGATCCCCCCGGAATCGACCTAGCAAGTGTTGAGTGGCTTGTAGTAGACGAATCAGATAAACTGTTTGAAGATGGCAAAACTGGGTTCAGAGACCAGCTGGCTTCCATTTTCCTGGCCTGCACATCCCACAAGGTCCGAAGAGCTATGTTCAGTGCAACTTTTGCATATGATGTTGAACAGTGGTGCAAACTCAACCTGGACAATGTCATCAGTGTGTCCATTGGAGCAAGGAATTCTGCAGTAGAAACTGTAGAACAAGAGCTTCTCTTTGTTGGATCTGAGACCGGAAAACTTCTGGCCGTGAGAGAACTTGTTAAAAAGGGTTTCAATCCACCTGTTCTTGTTTTTGTTCAGTCCATTGAAAGGGCTAAAGAACTTTTTCATGAGCTCATATATGAAGGTATTAATGTGGATGTTATTCATGCAGAGAGAACACAACAACAGAGAGATAACACAGTCCACAGTTTCAGAGCAGGAAAAATCTGGGTTCTGATTTGTACAGCCTTGCTAGCAAGAGGGATTGATTTTAAAGGTGTGAACTTGGTGATCAACTATGACTTTCCAACTAGCTCAGTGGAATATATCCACAGGATAGGTCGAACTGGAAGAGCAGGGAATAAGGGAAAAGCAATTACATTTTTCACTGAGGATGATAAGCCATTATTAAGAAGCGTTGCTAATGTTATACAGCAGGCTGGGTGTCCTGTACCAGAATACATAAAAGGTTTTCAGAAACTACTAAGCAAACAAAAGAAAAAGATGATTAAGAAACCATTGGAAAGGGAGAGCATTAGTACAACTCCAAAATGTTTCTTAGAAAAAGCTAAGGATAAACAGAAAAAGGTCACTGGTCAGAACAGCAAGAAGAAAGTAGCTCTTGAAGACAAAAGTTAAAAACAGACTTTAAAAATACTGTCCCAGAAATGTAATTTTATGATCCCAGCATGAATGTTATTTTCATGGAATACTTGAAGTCTTACAGTCACCTGTACCAAACATTTGAAATCAACTACAAGTACATGGGACTGGTGATAAATGATCCTAAACTATCAAGTCAGTTTCAATTTGTAGGTGCCTTTTTTTTTTCCTGTAGAGATGAGGGTCTTGCCATGTTGTCCAGGCTGATCTGGAACTCCTGGC