Transcript asmbl_46273

Sequence
Transcript Sequence for observation asmbl_46273 of TGE0056208:
CTGGCGCGGCGCGGAGAGTGGGCTGGAGGCCGGGGCGGGACGCGTTGTGCAGCGGGTAAGCGCACGGCCGAGCGAGCATGGAGGGGGACCGGGTGGCCGGGCGGCCGGTGCTGTCGTCGTTACCAGTGCTACTGCTGCTGCCGTTGCTAATGTTGCGGGCCGCGGCGCTGCACCCAGACGAGCTCTTCCCACACGGGGAGTCGTGGGGGGACCAGCTCCTGCAGGAAGGCGACGACGAAAGCTCAGCCGTGGTGAAGCTGGCGAATCCCCTGCACTTCTACGAAGCCCGATTCAGCAACCTCTACGTGGGCACCAACGGCATCATCTCCACTCAGGACTTCCCCAGGGAAACGCAGTATGTGGACTATGATTTCCCCACCGACTTCCCGGCCATCGCCCCTTTTCTGGCGGACATCGACACGAGCCACGGCAGAGGCCGAGTCCTGTACCGAGAGGACACCTCCCCCGCAGTGCTGGGCCTGGCCGCCCGCTATGTGCGCGCTGGCTTCCCGCGCTCTGCGCGCTTTACCCCCACCCACGCCTTCCTGGCCACCTGGGAGCAGGTAGGCGCTTACGAGGAGGTCAAGCGCGGGGCGCTGCCCTCGGGAGAGCTGAACACTTTCCAGGCAGTTTTGGCATCTGATGGGTCTGATAGCTACGCCCTCTTTCTTTATCCTGCCAACGGCCTGCAGTTCCTTGGAACCCGCCCCAAAGAGTCTTACAATGTCCAGCTTCAGCTTCCAGCTCGGGTGGGCTTCTGCCGAGGGGAGGCTGATGATCTGAAGTCAGAAGGACCATATTTCAGCTTGACTAGCACTGAACAGTCTGTGAAAAATCTCTATCAACTAAGCAACCTGGGGATCCCTGGAGTGTGGGCTTTCCATATCGGCAGCACTTCCCCGTTGGACAATGTCAGGCCAGCTGCAGTTGGAGACCTTTCCGCTGCCCACTCTTCTGTTCCCCTGGGACGTTCCTTCAGCCATGCTACAGCCCTGGAAAGTGACTATAATGAGGACAATTTGGATTACTATGATGTGAATGAGGAGGAAGCTGAATACCTTCCGGGTGAACCAGAGGAGGCATTGAATGGCCACAGCAGCATTGATGTTTCCTTCCAATCCAAAGTGGATACAAAGCCTTTAGAGGAATCTTCCACCTTGGATCCTCACACCAAAGAAGGAACATCTCTGGGAGAGGTAGGGGGCCCAGATTTAAAAGGCCAAGTTGAGCCCTGGGATGAGAGAGAGACCAGAAGCCCAGCTCCACCAGAGGTAGACAGAGATTCACTGGCTCCTTCCTGGGAAACCCCACCACCGTACCCCGAAAACGGAAGCATCCAGCCCTACCCAGATGGAGGGCCAGTGCCTTCGGAAATGGATGTTCCCCCAGCTCATCCTGAAGAAGAAATTGTTCTTCGAAGTTACCCTGCTTCAGGTCACACTACACCCTTAAGTCGAGGGACGTATGAGGTGGGACTGGAAGACAACATAGGTTCCAACACCGAGGTCTTCACGTATAATGCTGCCAACAAGGAAACCTGTGAACACAACCACAGACAATGCTCCCGGCATGCCTTCTGCACGGACTATGCCACTGGCTTCTGCTGCCACTGCCAATCCAAGTTTTATGGAAATGGGAAGCACTGTCTGCCTGAAGGGGCACCTCACCGAGTGAATGGGAAAGTGAGTGGCCACCTCCACGTGGGCCATACACCCGTGCACTTCACTGATGTGGACCTGCATGCGTATATCGTGGGCAATGATGGCAGAGCCTACACGGCCATCAGCCACATCCCACAGCCAGCAGCCCAGGCCCTCCTCCCCCTCACACCAATTGGAGGCCTGTTTGGCTGGCTCTTTGCTTTAGAAAAACCTGGCTCTGAGAACGGCTTCAGCCTCGCAGGTGCTGCCTTTACCCATGACATGGAAGTTACATTCTACCCGGGAGAGGAGACGGTTCGTATCACTCAAACTGCTGAGGGACTTGACCCAGAGAACTACCTGAGCATTAAGACCAACATTCAAGGCCAGGTGCCTTACGTCTCAGCAAATTTCACAGCCCACATCTCTCCCTACAAGGAGCTGTACCACTACTCCGACTCCACTGTGACCTCTACAAGTTCCAGAGACTACTCTCTGACTTTTGGTGCAATCAACCAAACATGGTCCTACCGCATCCACCAGAACATCACTTACCAGGTGTGCAGGCACGCCCCCAGACACCCGTCCTTCCCCACCACCCAGCAGCTGAACGTGGACCGGGTCTTTGCCTTGTATAATGACGAAGAAAGAGTGCTTAGATTTGCTGTGACCAATCAAATTGGCCCGGTCAAAGAGGATTCAGACCCCACTCCGGGGAATCCTTGCTATGATGGGAGCCACATGTGTGACACAACAGCACGGTGCCATCCAGGGACAGGTGTAGATTACACCTGTGAGTGCGCATCTGGGTACCAGGGAGATGGACGGAACTGTGTGGATGAAAATGAATGTGCAACTGGCTTTCATCGCTGTGGCCCCAACTCTGTATGTATCAACTTGCCTGGAAGCTACAGGTGTGAGTGCCGGAGTGGTTATGAGTTTGCAGATGACCGGCATACTTGCATCTTGATCACCCCACCTGCCAACCCCTGTGAGGATGGCAGTCATACCTGTGCTCCTGCTGGGCAGGCCCGGTGTGTTCACCATGGAGGCAGCACGTTCAGCTGTGCCTGCCTGCCTGGTTATGCCGGCGATGGGCACCAGTGCACTGATGTAGATGAATGCTCAGAAAACAGATGTCACCCTGCAGCTACCTGCTACAATACTCCTGGTTCCTTCTCCTGCCGTTGTCAACCCGGATATTATGGGGATGGATTTCAGTGCATACCTGACTCCACCTCAAGCCTGACACCCTGTGAACAACAGCAGCGCCATGCCCAGGCCCAGTATGCCTACCCTGGGGCCCGGTTCCACATCCCCCAATGCGACGAGCAGGGCAACTTCCTGCCCCTACAGTGTCATGGCAGCACTGGTTTCTGCTGGTGCGTGGACCCTGATGGTCATGAAGTTCCTGGTACCCAGACTCCACCTGGCTCCACCCCGCCTCACTGTGGACCATCACCAGAGCCCACCCAGAGGCCCCCGACCATCTGTGAGCGCTGGAGGGAAAACCTGCTGGAGCACTACGGTGGCACCCCCCGGGATGACCAGTACGTGCCCCAGTGCGATGACCTGGGCCACTTCATCCCCCTGCAGTGCCACGGAAAGAGCGACTTCTGCTGGTGTGTGGACAAAGATGGCAGAGAGGTGCAGGGCACCCGCTCCCAGCCAGGCACCACCCCTGCGTGTATACCCACCGTCGCTCCACCCATGGTCCGGCCCACGCCCCGGCCAGATGTGACCCCTCCATCTGTGGGCACCTTCCTGCTCTATACTCAGGGCCAGCAGATTGGCTACTTACCCCTCAATGGCACCAGGCTTCAGAAGGATGCAGCTAAGACCCTGCTGTCTCTGCATGGCTCCATAATCGTGGGAATTGATTACGACTGCCGGGAGAGGATGGTGTACTGGACAGATGTTGCTGGACGGACAATCAGCCGTGCTGGTCTGGAACTGGGAGCAGAGCCTGAGACGATCGTGAATTCAGGTCTGATAAGCCCTGAAGGACTTGCCATAGACCACATCCGCAGAACAATGTACTGGACGGACAGTGTCCTGGATAAGATAGAGAGCGCCCTGCTGGATGGCTCTGAGCGCAAGGTCCTCTTCTACACAGATCTGGTGAATCCCCGTGCCATCGCTGTGGATCCAATCCGAGGCAACTTGTACTGGACAGACTGGAATAGAGAAGCTCCTAAAATTGAAACGTCATCTTTAGATGGAGAAAACAGAAGAATTCTGATCAATACAGACATTGGATTGCCCAATGGCTTAACCTTTGACCCTTTCTCTAAACTGCTCTGCTGGGCAGATGCAGGAACCAAAAAACTGGAGTGTACACTACCTGATGGAACTGGACGGCGTGTCATTCAAAACAACCTCAAGTACCCCTTCAGCATCGTAAGCTATGCAGATCACTTCTACCACACAGACTGGAGGAGGGATGGTGTTGTATCAGTAAATAAACATAGTGGCCAGTTTACTGATGAGTATCTCCCAGAACAACGATCTCACCTCTACGGGATAACTGCAGTCTACCCCTACTGCCCAACAGGAAGAAAGTAAGTACAGTAATGTAAAGGAAGACTTGGAGTTTACAATCAGAACCTGGACCCTAAAGAACAGTGACTGCAAAGGCAAAGAAAGTAAAAAAGGAATTGGCCATTAGACGTTCCTGAGCATCCAAGATGAACATTTTGTAGTGCAAAAAGACTTTTGTGAAAAGCTGATACCTCAATCTTTACTACTGTATTTTTAAAAATGAAGGTTGTTATTGCAAGTTTAAAAAGGTAACAGAATTTTAACTGTTGCTTATTAAAGCAACTTCTTGTAAACATTTATCATTAATATTTAAAAGATCAAATTCATTCAACTAAGAATTAGAGTTTAAGACTCTAAACCTGATTTTTGCCATGGATTCCTTCTGGCCAAGAAATTAAAGCACATGTGATCAATATAACAATATAATCCTAAACCTTGACAGTTGGAGAAGCCAATGCAGAACTGATGGGAAAGGACCAATTATTTATAGTTTCCCAACAAAAGTTCTAAGATTTTTTACCTCTGCATCAGTGCATTTCTATTTATATCAAAAGGTGCTAAAATGATTCAATTTGCATTTTCTGATCCTGTAGTGCCTCTATAGAAGTACCCACAGAAAGTAAAGTATCACATTTATAAATACCAAAGATGTAACAATTTTAAAATTTTCTAGATTACTCCAATAAAGTGTTTTAAGTTTTCCTATGACTTAAGGATCTATATTGTCTCTAGGACAAAGCTGGGGGTTGGCATATATGCCTTAACCACAAAGGAGAAAGGTGATTTATGCAAACATACAGTACATAATAAAAATTCTACTTTCCTAAACTTTATTAAAGAAAAAAGCAATAAGCAATGGTGGTAAATCTCTAGAACATACCCAATTTTCTGGGCTTCCTCCCCCGAGAATGTGACATTTTGATTTCCAAACATGCCAGAAGTGTATGGTTCCCAACTGTACTAAGTAGGTGAGAAGCTGAAGTCCTCAAGTGTTCATCTTCCAACTTTTCCCAGTCTGTGGTCTGTCTTTGGATCAGCAATAATTGCCTGAACAGCTACTATGGCTTCGTTGATTTTTGTCTGTAGCTCTCTGAGCTCCTCTATGTGCAGCAATCGCAGAATTTGAGCAGCTTCATTAAGAACTGCATCTGTTTTATGAGAAAAGAACACTGCTTCAATACATAATTTTTACATTTAAGGCCATTTATTTCCTCCCAAGTATTCAGTCTGTAAAAAAAATAGTTTGAATTTAAACAAAATCACTTACCTCCTGTGTCAAAACCAAGAATATGTTTGTCTAAAGCAACAGGTAAGCCCTTTAAAAAAAGAAAGACAAAATGAGAGTATTTATGGTTAAGAATAGCATCCTTTCCTCAACTGAAACTGAAAAGCACCTAGCTATTCTGGTGTCTTAACTCTTTTAGCTGCATGGGCAAGGGAACTAGGAATTTTGTTTATATTTGCTTTGTGATGATTGTGATTAGCGAGTTTTCCCTATTTCAACCGGTTAGGGGGAAAAGTTAACCTTTAAATGTACCAGGAAGCTCTATAGCTCATCCAATCCTTTAGCCCAGGCATACAAAACAATATATCCTTATTGCAGCAGTGCCTTGTCATTACTGCTATGGAAGGCAAGTTGAGCCAGGCTGTTACTGTCTTATTTTGGCGACAGTAAGCAACAGTATAAACGGCAAAAATAGTACCTTATATTCCATTTCTGAGCACATTAATTTGTCTTTACAAATTGTACGAACCTTTCAGCCAGCATGGTGTTTGCCAAGATTATGTATAATTATGTATAATTTAACTTTCAAGACTTGACTTGGAAGTTACTTTGAAACAAACAGTCTAGGAAAATGAAAAACTAAACCACTCAGCACCTATGGACATACTAAAGATGGTGACTATGGTGATGCCAAACTTCACAGAAACAAATTCTAAAATGAGGACAGTCTGTACTTCCTGCTGATTATATAAAATCACTGCCAAGAAAAACACACTACCCGTACTTTCAATCTTTCAATGTTACAACCTGTTACTATTCAAATGCTTTAGTCACTGCTCAATTCTTGCCTTATCTAGTAATGTAAATCTACGTAGGCTCTGTCTGCTTTAAAACAGCTAACACATGTAAGTCTGAAGAAACCAATGGGTACGAAAGCACAAGTGAGCAAAATTAAAGAGCAGAATTGTACTGAGTGGCTTTATATGTTCATCTAGTACCAGAGGCTCCACTTTTTTTTCCTTTGCCAACAGGCCACCAAGCTACCCCTGAAAACTACCATATGCCTCAAATAGTAGTTATAAATGCTTATAAGTACACTAGACTGTAAGAACTCCACTAAATTGTTATAGGCTGGTATCTTTTGAGATGACACCAAAATTAAAATTGGGAGCATTAAAAATAAAACTAAATTTTACTTTACAAACAAGAGCAAAGAGATTTGGCTAAGCCTTTACTTACACTGCCTTCCAAAGCATAGTTTTGCTGAAGGAATGAATGAATGAATGATTGACTTTATTACACCAGAACAATTTACTGTCTGTTCTATAGGGAGGGTGAAATAAGCTGATCTTTAACCCAACTTCCAGTGGCTCGATTCATATACAACGAGCCAGTAAGAACCTTTAAAAGAAAACAGTGTCTTTCAGAGATACTGCCCTGGCATTAGTAACCTTTTAACACTGCTTGGCCTGCCTAAAGGGGCTGGAGGACAAAAGGCATTGGGAGATGGGGGAAGGGCGCAGGGAGGACAAACAACATAGTTGTGCCCAAGGCATTCACTACAACATCATTGCTGCAGGAGGCAGGTGTTATCAGACACTGCTGCTGCTGACCTGAGGACAGTCTCTCCACCGCTGCACAGCCAGTGAAACTTTAGGCATCTTTGGATTTCTGATATAATCTAAAAATGTTCCATATTTTCTCTTTAAGGGGAAGGTAGTCATGGGATATAGCTTTTCTCAGCCTACAAGGTAGGACTGAAAGATACCATTTCAGTCACCTGTACCTTGAACCTTACACTCCAACAGAACCCCCTGTCCCTTCACCTGGGCAGACTGACAAGCTCATGCAGACATCCACGCATGGACCCTTCTCCCCACCTACCGTAAGAGCACAGGCTCTCAAGTCAGACTGCCTGAGCTCAGTCACTTACCAACTAGGTGACCTTAGCCAAATTACTTTCTCATGTTTTATGCCAGGAAATTGAATAAAACAAGAATTTACTCTGAAGAAATAAGAGCAAGGATAGAATTTAGATAGAAAAAGAAAACTAATTTGTAGTGAGGTGTGTTCCTTCTTCTCCAGCATGAGTCAAAATAATCCAGTAAGTTTCATATGGGTAACTCATTTTAAATAAACTTCAACGGGCCACAAGCATGATTTGTGGACTGTGCATGAGCTATTTGTGGCTTTTTTAAGGTACAAAGTGAGAGGAACATGAAGTTTTTCACTCAAAAATGACCCCCTAGCCACTGAATACATTCAATTTGCTTTAGGAAGCACTGAAGTAAGCTATCCTTTCTCTAAGTTGTAGAACGTAGAATGGATATCTTAAACAGATACATGCAAAGTTTAAAATCACGGCCATACCAGAAGAAATGTTCATTAACAACTTATTTAGGATTTATAGAAACGTACCTCTTTTGTTTGATTTGCCTTAGCAACTGCATCCTGTGTCAGGCGCTCCTGAACCAAAATCCGAATTGCCTAAGAAACCCAAAAATATTTTTACTTTTTATAGGCTGTGTACCTGTCATCCTTTCTTCTATGAGCCCAGAGAATAAGGATGCTCATTTTGATGAAGTCAGAATTACCTAAGTTCATTAATAAACTCCCCATTAAATTAAAAATAAAAAAAACCCACTAATATAACGTAACCTTTCACACTTCTAGTATTTTAATAATGTTGAATGGTGCTTGCAACAATTAAAACCATTTTTTGAATAGGTAATGCACGTGACTGGTAAAAAACAACTTTAAATACAGCAAGACACATGGTAAAAAGTAGGTCTCCTTCCTACCTGAGCCTTGCGATCCCCTACAGATTCCTTACCCTCACTAAAACTGCGAAATGACGAGCATGCTTAGCACGAATACACATTTTTGACACAAAGGGTAGCAGATCATACATACTGTCTTACACTTTGCTTTTATCACTTCACTCTAGTAAAATATTTTCAAACCTTTCAAAGGACACCGTTGGTGGTTTTAATCACCAAGGCATTTCATTATGGTAGGCATGCATGCAAGTATCCATACACACTTAAAAATCAAATTTTAAAAAAATGGAATTTTAATTAGGAAGATGA