Transcript asmbl_14254

Sequence
Transcript Sequence for observation asmbl_14254 of TGE0003057:
CGGGAAGCTCTTTGAGAACAGGGATTGGATCTAGTCTACTCCTGTATTCTCAGCACCCAGCACAAAAGGAGGACCTATTAGAGCCTTTGCCCCGGCGTCGGTGACTCAGTGTTCGCGGGAGCGCCGCACCTACACCAGCCAACCCAGATCCCGAGGTCCGACAGCGCCCGGCCCAGATCCCCACGCCTGCCAGGAGCAAGCCGAGAGCCAGCCGGCCGGCGCACTCCGACTCCGAGCAGTCTCTGTCCTTCGACCCGAGCCCCGCGCCCTTTCCGGGACCCCTGCCCCGCGGGCAGCGCTGCCAACCTGCCGGCCATGGAGACCCCGTCCCAGCGGCGCGCCACCCGCAGCGGGGCGCAGGCCAGCTCCACTCCGCTGTCGCCCACCCGCATCACCCGGCTGCAGGAGAAGGAGGACCTGCAGGAGCTCAATGATCGCTTGGCGGTCTACATCGACCGTGTGCGCTCGCTGGAAACGGAGAACGCAGGGCTGCGCCTTCGCATCACCGAGTCTGAAGAGGTGGTCAGCCGCGAGGTGTCCGGCATCAAGGCCGCCTACGAGGCCGAGCTCGGGGATGCCCGCAAGACCCTTGACTCAGTAGCCAAGGAGCGCGCCCGCCTGCAGCTGGAGCTGAGCAAAGTGCGTGAGGAGTTTAAGGAGCTGAAAGCGCGCAATACCAAGAAGGAGGGTGACCTGATAGCTGCTCAGGCTCGGCTGAAGGACCTGGAGGCTCTGCTGAACTCCAAGGAGGCCGCACTGAGCACTGCTCTCAGTGAGAAGCGCACGCTGGAGGGCGAGCTGCATGATCTGCGGGGCCAGGTGGCCAAGCTTGAGGCAGCCCTAGGTGAGGCCAAGAAGCAACTTCAGGATGAGATGCTGCGGCGGGTGGATGCTGAGAACAGGCTGCAGACCATGAAGGAGGAACTGGACTTCCAGAAGAACATCTACAGTGAGGAGCTGCGTGAGACCAAGCGCCGTCATGAGACCCGACTGGTGGAGATTGACAATGGGAAGCAGCGTGAGTTTGAGAGCCGGCTGGCGGATGCGCTGCAGGAACTGCGGGCCCAGCATGAGGACCAGGTGGAGCAGTATAAGAAGGAGCTGGAGAAGACTTATTCTGCCAAGCTGGACAATGCCAGGCAGTCTGCTGAGAGGAACAGCAACCTGGTGGGGGCTGCCCACGAGGAGCTGCAGCAGTCGCGCATCCGCATCGACAGCCTCTCTGCCCAGCTCAGCCAGCTCCAGAAGCAGCTGGCAGCCAAGGAGGCGAAGCTTCGAGACCTGGAGGACTCACTGGCCCGTGAGCGGGACACCAGCCGGCGGCTGCTGGCGGAAAAGGAGCGGGAGATGGCCGAGATGCGGGCAAGGATGCAGCAGCAGCTGGACGAGTACCAGGAGCTTCTGGACATCAAGCTGGCCCTGGACATGGAGATCCACGCCTACCGCAAGCTCTTGGAGGGCGAGGAGGAGAGGCTACGCCTGTCCCCCAGCCCTACCTCGCAGCGCAGCCGTGGCCGTGCTTCCTCTCACTCATCCCAGACACAGGGTGGGGGCAGCGTCACCAAAAAGCGCAAACTGGAGTCCACTGAGAGCCGCAGCAGCTTCTCACAGCACGCACGCACTAGCGGGCGCGTGGCCGTGGAGGAGGTGGATGAGGAGGGCAAGTTTGTCCGGCTGCGCAACAAGTCCAATGAGGACCAGTCCATGGGCAATTGGCAGATCAAGCGCCAGAATGGAGATGATCCCTTGCTGACTTACCGGTTCCCACCAAAGTTCACCCTGAAGGCTGGGCAGGTGGTGACGATCTGGGCTGCAGGAGCTGGGGCCACCCACAGCCCCCCTACCGACCTGGTGTGGAAGGCACAGAACACCTGGGGCTGCGGGAACAGCCTGCGTACGGCTCTCATCAACTCCACTGGGGAAGAAGTGGCCATGCGCAAGCTGGTGCGCTCAGTGACTGTGGTTGAGGACGACGAGGATGAGGATGGAGATGACCTGCTCCATCACCACCACGTGAGTGGTAGCCGCCGCTGAGGCCGAGCCTGCACTGGGGCCACCCAGCCAGGCCTGGGGGCAGCCTCTCCCCAGCCTCCCCGTGCCAAAAATCTTTTCATTAAAGAATGTTTTGGAACTTTACTCGCTGGCCTGGCCTTTCTTCTCTCTCCTCCCTATACCTTGAACAGGGAACCCAGGTGTCTGGGTGCCCTACTCTGGTAAGGAAGGGAGTGGGAACTTTCTGATGCCATGGAATATTCCTGTGGGAGCAGTGGACAAGGGTCTGGATTTGTCTTCTGGGAAAGGGAGGGGAGGACAGACGTGGGGCATGCCCGCCCTGCCTCTCTCCCCCATTCTTGTTGCATGCATATCCTCTCATTTCCCTCATTTTTCCTGCAAGAATGTTCTCTCTCATTCCTGACCGCCCCTCCACTCCAATTAATAGTGCATGCCTGCTGCCCTACAAGCTTGCTCCCGTTCTCTCTTCTTTTCCTCTTAAGCTCAGAGTAGCTAGAACAGAGTCAGAGTCACTGCTCTGGTTCTCTGTCCCCAAGTCTTCCTGAGCCTTCTCCCCTTTTATGTCTTCCCTCTCCTCCTCCGGGCCCCTAGCCTCCCAAACCCCCATTGCCCGCTGGCTCCTTGGGCACAGAACCACACCTTCCTGCCTGGCGGCTGGGAGCCTGCAGGAGCCTGGAGCCTGGTTGGGCCTGAGTGGTCAGTCCCAGACTCGCCGTCCCGCCTGAGCCTTGTCTCCCTTCCCAGGGCTCCCACTGCAGCAGCTCGGGGGACCCCGCTGAGTACAACCTGCGCTCGCGCACCGTGCTGTGCGGGACCTGCGGGCAGCCTGCCGACAAGGCATCTGCCAGCGGCTCAGGAGCCCAGGTGGGCGGACCCATCTCCTCTGGCTCTTCTGCCTCCAGTGTCACGGTCACTCGCAGCTACCGCAGTGTGGGGGGCAGTGGGGG