Transcript asmbl_10194

Sequence
Transcript Sequence for observation asmbl_10194 of TGE0056880:
GGCGGCGCGGAGCGAGCGAGCGAGAGAGCGGCGCGGGCCGGGCCATGGGGTGGCGGGCGGCGGGCGCGCTGCTGCTGGCGCTGCTGCTGCACGGGCGGCTGCTGGCGGTGACCCATGGGCTGAGGGCATACGATGGCTTGTCTCTGCCTGAGGACATAGAGACCGTCACAGCAAGCCAAATGCGCTGGACACATTCGTACCTTTCTGATGATGAGGACATGCTGGCTGACAGCATCTCAGGAGACGACCTGGGCAGTGGGGACCTGGGCAGCGGGGACTTCCAGATGGTTTATTTCCGAGCCCTGGTGAATTTCACTCGCTCCATCGAGTACAGCCCTCAGCTGGAGGATGCAGGCTCCAGAGAGTTCCGAGAGGTGTCCGAGGCTGTGGTAGACACGCTGGAGTCGGAGTACTTGAAAATTCCCGGAGACCAGGTTGTCAGTGTGGTGTTCATCAAGGAGCTGGATGGCTGGGTTTTTGTGGAGCTGGATGTGGGCTCGGAAGGGAATGCGGATGGGGCTCAGATTCAGGAGATGCTGCTCAGGGTCATCTCCAGCGGCTCTGTGGCCTCCTACGTCACCTCTCCCCAGGGATTCCAGTTCCGACGCCTGGGCACAGTGCCCCAGTTCCCAAGAGCCTGCACGGAGGCCGAGTTTGCCTGCCACAGCTACAATGAGTGTGTGGCCCTGGAGTATCGCTGTGACCGGCGGCCCGACTGCAGGGACATGTCTGATGAGCTCAATTGTGAGGAGCCAGTCCTGGGTATCAGCCCCACATTCTCTCTCCTTGTGGAGACGACATCTTTACCGCCCCGGCCAGAGACAACCATCATGCGACAGCCACCAGTCACCCACGCTCCTCAGCCCCTGCTTCCCGGTTCCGTCAGGCCCCTGCCCTGTGGGCCCCAGGAGGCCGCATGCCGCAATGGGCACTGCATCCCCAGAGACTACCTCTGCGACGGACAGGAGGACTGCGAGGACGGCAGCGATGAGCTAGACTGTGGCCCCCCGCCACCCTGTGAGCCCAACGAGTTCCCCTGCGGGAATGGACATTGTGCCCTCAAGCTGTGGCGCTGCGATGGTGACTTTGACTGTGAGGACCGAACTGATGAAGCCAACTGCCCCACCAAGCGTCCTGAGGAAGTGTGCGGGCCCACACAGTTCCGATGCGTCTCTACCAACATGTGCATCCCAGCCAGCTTCCACTGTGACGAGGAGAGCGACTGTCCTGACCGGAGCGACGAGTTTGGCTGCATGCCCCCCCAGGTGGTGACACCTCCCCGGGAGTCCATCCAGGCTTCCCGGGGCCAGACAGTGACCTTCACCTGCGTGGCCATTGGCGTCCCCACCCCCATCATCAATTGGAGGCTCAACTGGGGCCACATCCCCTCTCATCCCAGGGTGACAGTGACCAGCGAGGGTGGCCGTGGCACACTGATCATCCGTGATGTGAAGGAGTCAGACCAGGGTGCCTACACCTGTGAGGCCATGAACGCCCGGGGCATGGTGTTTGGCATTCCTGACGGTGTCCTTGAGCTCGTCCCACAACGAGCAGGCCCCTGCCCTGACGGCCACTTCTACCTGGAGCACAGCGCCGCCTGCCTGCCCTGCTTCTGCTTTGGCATCACCAGCGTGTGCCAGAGCACCCGCCGCTTCCGGGACCAGATCAGGCTGCGCTTTGACCAACCCGATGACTTCAAGGGTGTGAATGTGACAATGCCTGCGCAGCCCGGCACGCCACCCCTCTCCTCCACGCAGCTGCAGATCGACCCATCCCTGCACGAGTTCCAGCTAGTCGACCTGTCCCGCCGCTTCCTCGTCCACGACTCCTTCTGGGCTCTGCCTGAACAGTTCCTGGGCAACAAGGTGGACTCCTATGGCGGCTCCCTGCGTTACAACGTGCGCTACGAGTTGGCCCGTGGCATGCTGGAGCCAGTGCAGCGGCCGGACGTGGTCCTCATGGGTGCCGGGTACCGCCTCCTCTCCCGAGGCCACACACCCACCCAACCTGGTGCTCTGAACCAGCGCCAGGTCCAGTTCTCTGAGGAGCACTGGGTCCATGAGTCTGGCCGGCCGGTGCAGCGCGCGGAGCTGCTGCAGGTGCTGCAGAGCCTGGAGGCCGTGCTCATCCAGACCGTGTACAACACCAAGATGGCCAGCGTGGGACTTAGCGACATCGCCATGGATACCACCGTCACCCATGCCACCAGCCATGGCCGTGCCCACAGTGTGGAGGAGTGCAGATGCCCCATTGGCTATTCTGGCTTGTCCTGCGAGAGCTGTGATGCCCACTTCACTCGGGTGCCTGGTGGGCCCTACCTGGGCACCTGCTCTGGTTGCAATTGCAATGGCCATGCCAGCTCCTGTGACCCTGTGTATGGCCACTGCCTGAATTGCCAGCACAACACGGAGGGGCCACAGTGCAACAAGTGCAAGGCTGGCTTCTTTGGGGACGCCATGAAGGCCACGGCCACTTCCTGCCGGCCCTGCCCTTGCCCATACATCGATGCCTCCCGCAGATTCTCAGACACTTGCTTCCTGGACACGGATGGCCAAGCCACATGTGACGCCTGTGCCCCAGGCTACACTGGCCGCCGCTGTGAGAGCTGTGCCCCCGGATACGAGGGCAACCCCATCCAGCCCGGCGGGAAGTGCAGGCCCGTCAACCAGGAGATTGTGCGCTGTGACGAGCGTGGCAGCATGGGGACCTCCGGGGAGGCCTGCCGCTGTAAGAACAATGTGGTGGGGCGCTTGTGCAATGAATGTGCTGACGGCTCTTTCCACCTGAGTACCCGAAACCCCGATGGCTGCCTCAAGTGCTTCTGCATGGGTGTCAGTCGCCACTGCACCAGCTCTTCATGGAGCCGTGCCCAGTTGCATGGGGCCTCTGAGGAGCCTGGTCACTTCAGCCTGACCAACGCCGCAAGCACCCACACCACCAACGAGGGCATCTTCTCCCCCACGCCCGGGGAACTGGGATTCTCCTCCTTCCACAGACTCTTATCTGGACCCTACTTCTGGAGCCTCCCTTCACGCTTCCTGGGGGACAAGGTGACCTCCTATGGAGGAGAGCTGCGCTTCACAGTGACCCAGAGGTCCCAGCCGGGCTCCACACCCCTGCACGGGCAGCCGTTGGTGGTGCTGCAAGGTAACAACATCATCCTAGAGCACCATGTGGCCCAGGAGCCCAGCCCCGGCCAGCCCAGCACCTTCATTGTGCCTTTCCGGGAGCAAGCATGGCAGCGGCCCGATGGGCAGCCAGCCACACGGGAGCACCTGCTGATGGCACTGGCAGGCATCGACACCCTCCTGATCCGAGCATCCTACGCCCAGCAGCCCGCTGAGAGCAGGGTCTCTGGCATCAGCATGGACGTGGCTGTGCCCGAGGAAACCGGCCAGGACCCCGCGCTGGAAGTGGAACAGTGCTCCTGCCCACCCGGGTACCGTGGGCCGTCCTGCCAGGACTGTGACACAGGCTACACACGCACGCCCAGTGGCCTCTACCTGGGTACCTGTGAACGCTGCAGCTGCCATGGCCACTCAGAGGCCTGCGAGCCAGAAACAGGTGCCTGCCAGGGCTGCCAGCATCACACGGAGGGCCCTCGGTGTGAGCAGTGCCAGCCAGGATACTACGGGGACGCCCAGCGGGGGACACCACAGGACTGCCAGCTGTGCCCCTGCTACGGAGACCCTGCTGCCGGCCAGGCTGCCCACACTTGTTTTCTGGACACAGACGGCCACCCCACCTGTGATGCGTGCTCCCCAGGCCACAGTGGGCGTCACTGTGAGAGGTGCGCCCCTGGCTACTATGGCAACCCCAGCCAGGGCCAGCCATGCCAGAGAGACAGCCAGGTGCCAGGGCCCATAGGCTGCAACTGTGACCCCCAAGGCAGCGTCAGCAGCCAGTGTGATGCTGCTGGTCAGTGCCAGTGCAAGGCCCAGGTGGAAGGCCTCACTTGCAGCCACTGCCGGCCCCACCACTTCCACCTGAGTGCCAGCAACCCAGACGGCTGCCTGCCCTGCTTCTGTATGGGCATCACCCAGCAGTGCGCCAGCTCTGCCTACACACGCCACCTGATCTCCACCCACTTTGCCCCTGGGGACTTCCAAGGCTTTGCCCTGGTGAACCCACAGCGAAACAGCCGCCTGACAGGAGAATTCACTGTGGAACCCGTGCCCGAGGGTGCCCAGCTCTCTTTTGGCAACTTTGCCCAACTCGGCCATGAGTCCTTCTACTGGCAGCTGCCGGAGACATACCAGGGAGACAAGGTGGCGGCCTACGGTGGGAAGTTGCGATACACCCTCTCCTACACAGCAGGCCCACAGGGCAGCCCACTCTCTGACCCCGATGTGCAGATCACGGGCAACAACATCATGCTAGTGGCCTCCCAGCCAGCGCTGCAGGGCCCTGAGAGGAGGAGCTACGAGATCATGTTCCGAGAGGAATTCTGGCGCCGGCCCGATGGGCAGCCGGCCACACGCGAGCACCTCCTGATGGCACTGGCCGACCTGGATGAGCTCCTGATCCGGGCCACGTTCTCCTCCGTGCCGCTGGCGGCCAGCATCAGCGCAGTCAGCCTGGAGGTCGCCCAGCCGGGGCCCTCAAACAGACCCCGCGCCCTCGAGGTGGAGGAGTGCCGCTGCCCGCCAGGCTACATCGGTCTGTCCTGCCAGGACTGTGCCCCCGGCTACACGCGCACCGGGAGTGGGCTCTACCTCGGCCACTGCGAGCTATGTGAATGCAATGGCCACTCAGACCTGTGCCACCCAGAGACTGGGGCCTGCTCGCAATGCCAGCACAACGCCGCAGGGGAGTTCTGCGAGCTTTGTGCCCCTGGCTACTACGGAGATGCCACAGCCGGGACGCCTGAGGACTGCCAGCCCTGTGCCTGCCCACTGACCAACCCAGAGAACATGTTTTCCCGCACCTGTGAGAGCCTGGGAGCCGGCGGGTACCGCTGCACGGCCTGCGAACCCGGCTACACTGGCCAGTACTGTGAGCAGTGTGGCCCAGGTTACGTGGGTAACCCCAGTGTGCAAGGGGGCCAGTGCCTGCCAGAGACAAACCAAGCCCCACTGGTGGTCGAGGTCCATCCTGCTCGAAGCATAGTGCCCCAAGGTGGCTCCCACTCCCTGCGGTGTCAGGTCAGTGGGAGCCCACCCCACTACTTCTATTGGTCCCGTGAGGATGGGCGGCCTGTGCCCAGCGGCACCCAGCAGCGACATCAAGGCTCCGAGCTCCACTTCCCCAGCGTCCAGCCCTCGGATGCTGGGGTCTACATTTGCACCTGCCGTAATCTCCACCAATCCAATACCAGCCGGGCAGAGCTGCTGGTCACTGAGGCTCCAAGCAAGCCCATCACAGTGACTGTGGAGGAGCAGCGGAGCCAGAGCGTGCGCCCCGGAGCTGACGTCACCTTCATCTGCACAGCCAAAAGCAAGTCCCCAGCCTATACCCTGGTGTGGACCCGCCTGCACAACGGGAAACTGCCCACCCGAGCCATGGATTTCAATGGCATCCTGACCATTCGCAACGTCCAGCTGAGTGATGCAGGCACCTACGTGTGCACCGGCTCCAACATGTTTGCCATGGACCAGGGCACAGCCACTCTACATGTGCAGGCCTCGGGCACCTTGTCCGCCCCCGTGGTCTCCATCCATCCGCCACAGCTCACAGTGCAGCCCGGGCAACTGGCGGAGTTCCGCTGCAGCGCCACAGGGAGCCCCACGCCCACCCTCGAGTGGACAGGGGGCCCCGGCGGCCAGCTCCCTGCGAAGGCACAAATCCACGGCGGCATCCTGCGCCTGCCAGCTGTCGAGCCCACGGATCAGGCCCAGTACTTGTGCCGAGCCCACAGCAGCGCTGGGCAGCAGGTGGCCAGGGCTGTGCTCCACGTGCATGGGGGCGGTGGGCCCAGAGTCCAAGTGAGCCCAGAGAGGACCCAGGTCCACGCAGGCCGCACCGTCAGGCTGTACTGCAGGGCTGCAGGCGTGCCTAGCGCCACCATCACCTGGAGGAAGGAAGGGGGCAGCCTCCCACCACAGGCCCGGTCAGAGCGCACAGACATCGCGACACTGCTCATCCCAGCCATCACGACTGCTGACGCCGGCTTCTACCTCTGCGTGGCCACCAGCCCTGCAGGCACTGCCCAGGCCCGGATCCAAGTGGTTGTCCTTTCAGCCTCAGATGCCAGCCCACCGCCGGTCAAGATTGAGTCCTCATCGCCTTCTGTGACAGAAGGGCAAACACTCGACCTCAACTGTGTGGTGGCAGGGTCAGCCCATGCCCAGGTCACCTGGTACAGGCGAGGGGGTAGCCTGCCTCCCCACACCCAGGTGCACGGCTCCCGTCTGCGGCTCCCCCAGGTCTCACCAGCTGATTCTGGAGAATATGTGTGCCGTGTGGAGAATGGATCGGGCCCCAAGGAGGCCTCCATTACTGTGTCTGTGCTCCACGGCACCCATTCTGGCCCCAGCTACACCCCAGTGCCCGGCAGCACCCGGCCCATCCGCATCGAGCCCTCCTCCTCACACGTGGCGGAAGGGCAGACCCTGGATCTGAACTGCGTGGTGCCCGGGCAGGCCCACGCCCAGGTCACGTGGCACAAGCGTGGGGGCAGCCTCCCTGCCCGGCACCAGGTCCACGGCCCACTGCTGAGGCTGAACCAGGTGTCCCCGGCTGACTCTGGCGAGTACTCGTGCCAAGTGACCGGAAGCTCAGGCACCCTGGAGGCATCTGTCCTGGTCACAATTGAGCCCTCCAGCCCAGGACCCATTCCTGCTCCAGGACTGGCCCAGCCCATCTACATCGAGGCCTCCTCTTCACACGTGACTGAAGGGCAGACTCTGGATCTGAACTGTGTGGTGCCCGGGCAGGCCCATGCCCAGGTC