Transcript asmbl_18667

Sequence
Transcript Sequence for observation asmbl_18667 of TGE0003990:
CGCGTTTGGAGCCGCCGCGGTCCAGTCCTTCTGCCTGCCCGCCTGTTCGCTAGTCCCTCCTGCCGCCCGCCTGCTGGGCAGGGCCGGCCCGGCCCGGCCCGGCCATGGAGTCCTACGATATCATCGCCAACCAGCCCGTGGTCATCGACAACGGTTCGGGAGTGATCAAGGCTGGCTTTGCAGGAGACCAGATTCCCAAATACTGTTTCCCAAACTATGTCGGGCGCCCTAAGCACATGCGGGTGATGGCTGGAGCCTTGGAAGGGGACCTCTTCATGGGACCAAAAGCAGAGGAGCACCGGGGGCTTCTGGCCCTGCGCCACCCCATGGAGCACGGCGTTGTGCGGGACTGGAATGACATGGAGCGCATCTGGCAGTATGTCTACTCCAAGGACCAGCTGCAGACCTTCTCCGAGGAGCATCCTGTCCTTCTAACGGAAGCCCCGCTCAACCCAAGTAAGAACCGGGAGAAGGCGGCAGAGGTGTTTTTTGAGACCTTCAACGTGCCAGCCCTGTTTATCTCCATGCAGGCCGTGCTCAGCCTGTACGCAACAGGACGCACAACAGGAGTGGTCTTAGATTCAGGGGACGGGGTCACCCATGCTGTTCCCATCTACGAGGGCTTTGCCATGCCGCATTCCATCATGCGGGTGGACATTGCCGGCCGCGACGTCTCCCGCTATCTCCGGCTGCTGCTGCGCAAGGAAGGCGTTGACTTTCACACCTCAGCTGAGTTTGAGGTTGTCCGAACCATCAAAGAGCGGGCCTGCTACCTGTCCATCAACCCACAGAAGGATGAGGCTCTGGAGACAGAGAAGGTGCAGTATACTTTGCCGGATGGCAGCATACTCGACGTGGGGCCAGCACGATTCCGGGCCCCTGAGCTGCTGTTCCAGCCGGACCTGGTGGGGGACGAGAGTGAGGGGCTCCATGAGGTGCTGGCTTTTGCCATCCACAAGTCCGACCTGGACCTCCGCCGGACACTGTTCGCCAACATTGTGCTTTCAGGCGGCTCCACGCTGTTCAAAGGCTTTGGGGACCGATTACTAAGTGAAGTGAAGAAGCTTGCACCAAAGGATGTCAAAATCAAGATCTCGGCCCCCCAGGAACGGCTGTACTCCACATGGATCGGTGGCTCCATCCTGGCCTCACTGGACACTTTCAAGAAGATGTGGGTCTCCAAGAAGGAGTACGAGGAGGATGGCGCCCGTGCTATTCATCGTAAAACCTTCTAGCGCCCAAGGAGAAAGGCAGTGTGCTGGGCGAGTGGGAAGAAAGGGGCCAGAGCCCCAACCCTGTCTGGTCTGGGCCCACATACACCAGGCCCAGGGTTCCCTGTGTGCCCTGAACCCCGGGAAGGCGGTACAGCATCTTCCCTGCAGCCCTCCCCTTTGCACACACACGCACACACAGTAACGTTTAGCTGCATGGGTGGGGGTCTTGAGCTGGAACATAGAAATTGATGTGCCCAGCCATAGGTGGTTCTGGGTGTCCCTTTGGCAGGGCCAGTTAGGGCTACGGTTCCTGGCTCTGATCCTTGGGGCTGCTTCTTCCCCAGGCTCCAAGGCTTGACCCCCGAATGCCCCCGTTTCCTCTGACAGGGTCCCTCCCAGGACGAGGGCACCCGGGTGCCTGTGTAATTAGCCTTGGGGAGTGGGATAGAGGAGAAGGTGTCCAGCAGCTCCCCACTGGTGCATCCTTGCTTCTCGTGCCATCTCATCTTCCTGACCCGACAGAGTAGCACAGAGGGCCAGCCACTCCTGGCATAACTGGCCTCCCACACTGTCCCCCTCATCTTCCTGAGTGGATGTCTTTGTGTAGGCTGAGTACTGAGCAGTCTGCTGTCCCCAGTGAGGGGGTCTGACATAGGGTTGCACCCCCTGGAGCCAGGGCAGCAGATGCTTGGGGTTTGGACAGCCAGTCTGTTGCGCTGTCCCTTTCACAGTGCTTCACTGCCTTGCTTCTCCCCTGTCCTTTACCCTGGGCAAGCGTTAGTGGTCTTCCCTTGTTGAGAGTCAGACCCAGAGGGGTGAGGGGAAAGATCTCCTGTCCCACCTCACCCACTGGGAGGGTCATTACCCTGGGCCAGGGCCCCTCCCCGTCCCAGGTATGTACAATAATTTAACACAGTTGCCTGAAGAAAACTTTTTTGTAAATCATTATAGTAATAATTATCAACAA