Transcript asmbl_11111

Sequence
Transcript Sequence for observation asmbl_11111 of TGE0000085:
GCGCGGAGGGCGGGGGCGCGCGCGGATGGCCATCTTAAGTGGCCGCCTGGAGCCCAGGGCCGCTGTCCGGGGAAGGGGGCGCCGGAGCAGCCCGGGAGTTGAGGCCGGCGCTGCAGGCAGCGGCGGCTGCGCGGTGAACGAGGCGGCCTGCGCGGCGGAGTGCTGAGTCCCGATCCCCGGCTCTGTCCGGCCCACGGATCCTCAAGCCCGGGCCCCGGGCCCGGCCCCAGCCTCAGCCCTGAGCGTCTCGGGGCGGATGGCGCGGGGCGGCGGGGGCGGGCGGTGCTGAGCCCTGCGCGGGCCATGGCCTCGGCCTGCGGGGCGCCGGGCCCGGGGGGCGCCCTGGGCAGCCAGGCCCCCTCCTGGTACCACCGCGACCTGAGCCGGGCGGCCGCGGAGGAGCTGCTGGCCCGGGCGGGCCGCGATGGCAGCTTCCTGGTCCGAGACAGCGAGAGCGTGGCGGGGGCCTTCGCGCTCTGCGTCCTGTATCAGAAGCATGTGCACACGTATCGCATTCTGCCTGATGGAGAAGATTTCTTGGCTGTGCAGACCTCGCAGGGTGTGCCTGTGCGCCGCTTCCAGACCCTGGGTGAGCTCATCGGCCTGTACGCCCAGCCCAACCAGGGCCTTGTGTGCGCCCTGCTTCTTCCTGTAGAGGGTGAGCGAGAGCCGGACCCACCGGATGACCGGGATGCCTCAGATGGGGAGGATGAGAAGCCCCCGCTGCCCCCGCGCTCTGGCTCCACCAGCATTTCTGCCCCCACTGGGCCCAGCAGTCCCCTGCCAGCTCCTGAGACTCCCACAGCTCCAGCTGCTGAGAGGGATGGGGCAGAGGTGCTGGGACAGGTCAGCAGGACCTCCACTGACTTCTTAACCCCTCCCCAAAGTGCTCCCAATGGGCTGAGCACCGTCTCGCACGACTACCTGAAAGGCAGCTATGGGCTGGACCTGGAAGCTGTGAGGGGTGGAGCCAGCCACCTGCCCCACCTCACCCGTACCCTCGCTACCTCATGCCGGAGGCTGCACAGTGAGGTGGACAAGGTCCTGTCAGGCCTGGAGATCCTGTCCAAGGTGTTTGACCAGCAGAGCTCGCCCATGGTGACCCGCCTTTTGCAGCAGCAGAACCTGCCACAGACAGGGGAGCAGGAACTAGAGAGCCTGGTGCTGAAGCTGTCAGTGCTAAAGGACTTCCTGTCAGGCATCCAGAAGAAGGCCCTGAAGGCCCTACAGGACATGAGCTCCACAGCACCCCCAGCTCCGCAGCCATCCACACGTAAGGCCAAGACCATCCCCGTGCAGGCCTTTGAGGTGAAGCTAGATGTGACCCTGGGTGACCTGACCAAGATTGGGAAGTCACAGAAGTTCACGCTGAGCGTGGATGTGGAGGGTGGGCGGCTGGTGCTGCTGCGGAGACAGCGGGACTCCCAGGAGGACTGGACCACCTTCACGCACGACCGCATCCGCCAGCTCATTAAGTCCCAGCGTGTCCAGAACAAGCTGGGTGTTGTGTTTGAGAAGGAGAAGGACCGGACTCAGCGCAAGGACTTCATCTTTGTCAGTGCCCGGAAGCGGGAGGCCTTCTGCCAGCTGTTGCAGCTCATGAAGAACAAGCACTCCAAGCAGGACGAGCCCGACATGATCTCAGTCTTCATAGGCACCTGGAACATGGGAAGTGTACCACCTCCAAAAAACGTGACATCCTGGTTCACATCGAAGGGTCTGGGGAAGACCCTGGACGAGGTCACAGTGACCATACCCCATGACATCTATGTCTTTGGGACCCAGGAGAACTCAGTGGGCGACCGCGAGTGGCTGGACCTACTGCGCGGGGGCCTCAAGGAGCTTACGGATCTGGATTACCGCCCGATTGCCATGCAATCACTGTGGAATATCAAGGTGGCAGTGCTGGTCAAGCCAGAGCACGAGAACCGTATCAGCCATGTCAGTACGTCCAGTGTGAAGACTGGCATCGCCAACACCCTGGGGAACAAGGGGGCTGTGGGCGTCTCCTTCATGTTTAATGGCACCTCATTTGGCTTTGTGAATTGTCACCTCACCTCGGGAAATGAGAAGACGGCTCGGAGGAACCAAAACTACTTGGACATCCTGCGGCTGCTCTCGCTGGGCGACCGGCAGCTCAATGCCTTTGACATCTCTCTGCGTTTCACACACCTCTTCTGGTTTGGGGACCTCAACTACCGCCTGGACATGGATATCCAGGAGATCCTGAACTACATCAGCAGGAAAGAGTTTGAGCCCCTCCTCAGGGTGGACCAGCTCAACCTGGAGCGGGAGAAGCACAAGGTCTTCCTTCGATTCAGTGAGGAGGAGATCTCCTTCCCACCCACCTACCGCTATGAGCGGGGTTCCCGGGACACATATGCCTGGCACAAGCAGAAGCCAACTGGGGTCCGGACCAATGTGCCCTCATGGTGTGACCGGATTCTGTGGAAATCCTACCCTGAAACTCACATCATCTGCAATTCTTATGGTTGCACTGATGACATCGTCACCAGCGACCATTCCCCCGTGTTTGGGACATTTGAGGTTGGAGTTACCTCCCAGTTCATCTCCAAGAAAGGGCTCTCAAAGACTTCAGACCAGGCCTACATTGAGTTTGAGAGCATCGAGGCCATTGTGAAGACAGCCAGCCGCACCAAGTTCTTCATCGAGTTCTACTCTACCTGCCTGGAGGAATACAAGAAGAGCTTTGAGAATGATGCCCAGAGCAGTGACAACATCAACTTCCTCAAAGTGCAGTGGTCTTCACGCCAGCTGCCCACGCTCAAACCAATTCTGGCTGATATCGAGTACCTGCAGGACCAGCACCTCCTGCTCACAGTCAAGTCCATGGATGGCTATGAATCCTATGGGGAGTGTGTGGTTGCACTCAAATCCATGATCGGCAGCACGGCCCAACAGTTCCTGACCTTCCTATCCCACCGTGGCGAGGAGACAGGCAATATCAGAGGCTCCATGAAGGTGCGGGTGCCCACGGAGCGCCTGGGCACCCGTGAGCGGCTCTACGAGTGGATCAGCATTGATAAGGATGAGGCAGGAGCAAAGAGCAAAGCCCCCTCTGTGTCCCGAGGGAGCCAGGAGCCCAGGTCAGGGAGCCGCAAGCCAGCCTTCACAGAGGCCTCCTGCCCGCTCTCCAGGTTATTTGAAGAACCAGAGAAACCGCCACCAACGGGGAGGCCCCCAGCCCCACCCCGAGCAGCTCCCCGGGAGGAGCCCTTGACCCCCAGGTTGAAGCCAGAGGGAGCTCCTGAACCAGAAGGGGTGGCGGCCCCCCCACCCAAGAACAGCTTCAATAACCCTGCCTACTACGTCCTTGAAGGGGTCCCGCACCAGCTGCTGCCCCCGGAGCCACCCTCGCCTGCCAGGGCCCCTGTCCCATCTGCCACCAAGAACAAAGTGGCCATTACAGTGCCTGCTCCACAGCTTGGGCACCACCGGCACCCTCGTGTGGGAGAGGGGAGTTCTTCAGATGAGGAGTCTGGAGGCACACTGCCCCCTCCAGACTTTCCACCTCCACCACTGCCGGACTCAGCCATCTTCCTGCCCCCCAGCCTGGATCCTTTACCAGGGCCAGTGGTCCGGGGCCGTGGTGGGGCTGAGGCCCGTGGCCCACCACCTCCCAAGGCCCATCCAAGGCCTCCACTGCCCCCAGGCCCCTCACCAGCCAGCACTTTCCTGGGGGAAGTGGCCAGTGGGGATGACCGGTCCTGCTCGGTGCTGCAGATGGCCAAGACGCTGAGCGAGGTGGACTATGCCCCTGCTGGGCCTGCACGCTCAGCGCTCCTCCCAGGCCCCCTGGAGCTGCAGCCCCCCCGGGGACTGCCCTCGGACTATGGCCGGCCCCTCAGCTTCCCTCCACCCCGCATCCGGGAGAGCATCCAGGAAGACCTGGCAGAGGAGGCTCCGTGCCTGCAGGGCGGGCGGGCCAGCGGGCTGGGCGAGGCAGGCATGAGTGCCTGGCTGCGGGCCATCGGCTTGGAGCGCTATGAGGAGGGCCTGGTGCATAATGGCTGGGACGACCTGGAGTTTCTCAGTGACATCACCGAGGAGGACTTGGAGGAGGCTGGGGTGCAGGACCCGGCTCACAAGCGCCTCCTTCTGGACACCCTGCAGCTCAGCAAGTGATAGCGGAGGCACCACGAAGCTGTGAACTCAGAGCCCCTCCCTGCTACCAAGGCCCAGCTATGGCCCCAGGGTTGAAAAGTTATGAGGGTCAGGGCAGTATCTCTCTGCCTATTTATTGGGGTGCCTATTTATTGGGGATCTGCATTCCCCGCTGCCCAATCATTTGCAATGCCCTAATTAGGGCATCCTGCCCCTCGCCTTTTAGGCTCAGGACGGAAGGTCAGTTGCCATGGTTACCGAGGACCCTGGTTACTCTGGTGCTGTCCTGTTTTACTGGACCCCGCCTCCCAGCCCCAGGGGTGCCTGTGGGGGTCCATTTGGGTACGTCTGGGCCCCCACTTTCACCAGTTTCTGCGGCCTTCCACCGGGCCTGAACCACAGCGGAGGAGCTCCGCTAAGACCTCCCCACCCCCGCTGGGGGTGGGGGCGGGTGTCCGTCCGGAAATGAAGGAATAGCCCGAGGACCGGGCTGGGGTTTATTTAAACTGTTCTGTGTGGGTCTGGGGAGGGAGAGCACCTTAATATTATTGGGGTTGGTTGGGGTGGGGCAGGATCTCAGCCATAAAGTGCCAGTTTGCTTAGTTCTCACTGTCTCCTGGTCTGTGCTGCCCTGCTCTGGGGATGCACGGCGGCAGGGTGGGGGAGGGAGGTTCCTCGCAGGTCTCAGCCCGGGACAGGGTCTTGCAAGCAGCCTCCTGGGCAGTCGTAAGGGTTGCGGCGTGATGTCTTCAATAAATTAAGTTTTATTTGGATTGAGTAAAACTTCAATAA