Transcript asmbl_66072

Sequence
Transcript Sequence for observation asmbl_66072 of TGE0056073:
AGATGACTCAGGTGAGGCTCGGCCGACGCCCGTGCTCCTCCCGTCCTTTCCCCAGTCATTTTCTGCCCGGCTTGATTTCTGACATTTAAGTGTTTCTTTCGCTGTTCCAGGCTCTGTTCCTCTCCCGGCATTTCCTCCCTGAAGCCTCCAGGTTTCTCATTTGGTTTCTGCCTGCGTTCTTTTCTTTTCTCCACACATCACACTGGCATGCAGCATGTTGTGGCGTGTGAGCATGGGGTGGCCGTGGGTCTCTGTCCCTGACTAAGCCGCCCCTTGTCCCTTCTCAGATTATGTTTGAGACCTTCAACACCCCGGCCATGTACGTGGCCATCCAGGCCGTGCTGTCCCTCTACGCCTCTGGGCGCACCACTGGCATTGTCATGGACTCTGGAGACGGGGTCACCCACACGGTGCCCATCTACGAGGGCTACGCCCTCCCCCACGCCATCCTGCGTCTGGACCTGGCTGGCCGGGACCTGACCGACTACCTCATGAAGATCCTCACTGAGCGAGGCTACAGCTTCACCACCACGGCCGAGCGGGAAATCGTGCGCGACATCAAGGAGAAGCTGTGCTACGTCGCCCTGGACTTCGAGCAGGAGATGGCCACCGCCGCATCCTCCTCTTCTCTGGAGAAGAGCTACGAGCTGCCCGATGGCCAGGTCATCACCATTGGCAATGAGCGGTTCCGGTGTCCGGAGGCGCTGTTCCAGCCTTCCTTCCTGGGTATGGAATCTTGCGGCATCCACGAGACCACCTTCAACTCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACGGTGCTGTCGGGCGGCACCACCATGTACCCGGGCATTGCCGACAGGATGCAGAAGGAGATCACCGCCCTGGCGCCCAGCACCATGAAGATCAAGATCATCGCACCCCCAGAGCGCAAGTACTCGGTGTGGATCGGTGGCTCCATCCTGGCCTCACTGTCCACCTTCCAGCAGATGTGGATTAGCAAGCAGGAGTACGACGAGTCGGGCCCCTCCATCGTCCACCGCAAATGCTTCTAAACGGACTCAGCAGATGCGTAGCATTTGCTGCATGGGTTAATTGAGAATAGAAATTTGCCCCTGGCAAATGCACACACCTCATGCTAGCCTCACGAAACTGGAATAAGCCTTCGAAAAGAAATTGTCCTTGAAGCTTGTATCTGATATCAGCACTGGATTGTAGAACTTGTTGCTGATTTTGACCTTGTATTGAAGTTAACTGTTCCCCTTGGTATTTGTTTAATACCCTGTACATATCTTTGAGTTCAACCTTTAGTACGTGTGGCTTGGTCACTTCGTGGCTAAGGTAAGAACGTGCTTGTGGAAGACAAGTCTGTGGCTTGGTGAGTCTGTGTGGCCAGCAGCCTCTGATCTGTGCAGGGTATTAACGTGTCAGGGCTGAGTGTTCTGGGATTTCTCTAGAGGCTGGCAAGAACCAGTTGTTTTGTCTTGCGGGTCTGTCAGGGTTGGAAAGTCCAAGCCGTAGGACCCAGTTTCCTTTCTTAGCTGATGTCTTTGGCCAGAACACCGTGGGCTGTTACTTGCTTTGAGTTGGAAGCGGTTTGCATTTACGCCTGTAAATGTATTCATTCTTAATTTATGTAAGGTTTTTTTTGTACGCAATTCTCGATTCTTTGAAGAGATGACAACAAATTTTGGTTTTCTACTGTTATGTGAGAACATTAGGCCCCAGCAACACGTCATTGTGTAAGGAAAAATAAAAGTGCTGCCGTAACCAATGAATGGCTCCTGTTTGGGGAAGTAGCAAGTGGGCTGGGAAAGACAGACCAACCTGGA