Transcript asmbl_66070

Sequence
Transcript Sequence for observation asmbl_66070 of TGE0056073:
CCGCTGCCAGCTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCTCTGCCGGTCGCAATGGAAGAAGAGATCGCCGCGCTGGTCATTGACAATGGCTCCGGCATGTGCAAAGCTGGTTTTGCTGGGGACGACGCTCCCCGAGCCGTGTTTCCTTCCATCGTCGGGCGCCCCAGACACCAGGGCGTCATGGTGGGCATGGGCCAGAAGGACTCCTACGTGGGCGACGAGGCCCAGAGCAAGCGTGGCATCCTGACCCTGAAGTACCCCATTGAGCATGGCATCGTCACCAACTGGGACGACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTGCGCGTGGCCCCGGAGGAGCACCCAGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACAGAGAGAAGATGACTCAGGCTCTGTTCCTCTCCCGGCATTTCCTCCCTGAAGCCTCCAGGTTTCTCATTTGGTTTCTGCCTGCGTTCTTTTCTTTTCTCCACACATCACACTGGCATGCAGCATGTTGTGGCGTGTGAGCATGGGGTGGCCGTGGGTCTCTGTCCCTGACTAAGCCGCCCCTTGTCCCTTCTCAGATTATGTTTGAGACCTTCAACACCCCGGCCATGTACGTGGCCATCCAGGCCGTGCTGTCCCTCTACGCCTCTGGGCGCACCACTGGCATTGTCATGGACTCTGGAGACGGGGTCACCCACACGGTGCCCATCTACGAGGGCTACGCCCTCCCCCACGCCATCCTGCGTCTGGACCTGGCTGGCCGGGACCTGACCGACTACCTCATGAAGATCCTCACTGAGCGAGGCTACAGCTTCACCACCACGGCCGAGCGGGAAATCGTGCGCGACATCAAGGAGAAGCTGTGCTACGTCGCCCTGGACTTCGAGCAGGAGATGGCCACCGCCGCATCCTCCTCTTCTCTGGAGAAGAGCTACGAGCTGCCCGATGGCCAGGTCATCACCATTGGCAATGAGCGGTTCCGGTGTCCGGAGGCGCTGTTCCAGCCTTCCTTCCTGGGTATGGAATCTTGCGGCATCCACGAGACCACCTTCAACTCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACGGTGCTGTCGGGCGGCACCACCATGTACCCGGGCATTGCCGACAGGATGCAGAAGGAGATCACCGCCCTGGCGCCCAGCACCATGAAGATCAAGATCATCGCACCCCCAGAGCGCAAGTACTCGGTGTGGATCGGTGGCTCCATCCTGGCCTCACTGTCCACCTTCCAGCAGATGTGGATTAGCAAGCAGGAGTACGACGAGTCGGGCCCCTCCATCGTCCACCGCAAATGCTTCTAAACGGACTCAGCAGATGCGTAGCATTTGCTGCATGGGTTAATTGAGAATAGAAATTTGCCCCTGGCAAATGCACACACCTCATGCTAGCCTCACGAAACTGGAATAAGCCTTCGAAAAGAAATTGTCCTTGAAGCTTGTATCTGATATCAGCACTGGATTGTAGAACTTGTTGCTGATTTTGACCTTGTATTGAAGTTAACTGTTCCCCTTGGTATTTGTTTAATACCCTGTACATATCTTTGAGTTCAACCTTTAGTACGTGTGGCTTGGTCACTTCGTGGCTAAGGTAAGAACGTGCTTGTGGAAGACAAGTCTGTGGCTTGGTGAGTCTGTGTGGCCAGCAGCCTCTGATCTGTGCAGGGTATTAACGTGTCAGGGCTGAGTGTTCTGGGATTTCTCTAGAGGCTGGCAAGAACCAGTTGTTTTGTCTTGCGGGTCTGTCAGGGTTGGAAAGTCCAAGCCGTAGGACCCAGTTTCCTTTCTTAGCTGATGTCTTTGGCCAGAACACCGTGGGCTGTTACTTGCTTTGAGTTGGAAGCGGTTTGCATTTACGCCTGTAAATGTATTCATTCTTAATTTATGTAAGGTTTTTTTTGTACGCAATTCTCGATTCTTTGAAGAGATGACAACAAATTTTGGTTTTCTACTGTTATGTGAGAACATTAGGCCCCAGCAACACGTCATTGTGTAAGGAAAAATAAAAGTGCTGCCGTAACCAATGAATGGCTCCTGTTTGGGGAAGTAGCAAGTGGGCTGGGAAAGACAGACCAACCTGGA