Transcript asmbl_64007

Sequence
Transcript Sequence for observation asmbl_64007 of TGE0056256:
CTTCCCCTTCCCCCTAGCCCCAACTCTCCCCAACTCCAACCCTGACCCAGAAAGTAGAGTGATTTGGAGGCTGGAAGACAAAACCATGTAAGGTCTGTGGAAATCACAGCTGTTCAGACCCGCCTCCAACCCCGGCCACCCCGCCCCCTTGCCCTAGCCTTCCTGTGTCCTTCCCACCCTTAGTCCCAGGCATCTGACTACCGGGAACCTCAGCCAGAGTCCGGGAGCCCCCCACCCCGTCCAGGAGCCAACAGAGCCCCCGTCTTGCTGGCGTGAGAATACATTGCTCTCCTTTGGTTGAATCAGCTGTCCCTCTTCGTGGGAAAATGAACCAGAAGACAATCCTCGTGCTCCTCATTCTGGCCGTCATCACCATCTTTGCCTTGGTTTGTGTCCTGCTGGTGGGCAGGGGTGGAGATGGGGGTGAACCCAGCCAGCTTCCCCATTGCCCCTCTGTATCTCCCAGTGCCCAGCCTTGGACACACCCTGGCCAGAGCCAGCTGTTTGCAGACCTGAGCCGAGAGGAGCTGACGGCTGTGATGCGCTTTCTGACCCAGCGGCTGGGGCCAGGGCTGGTGGATGCAGCCCAGGCCCGGCCCTCGGACAACTGTGTCTTCTCAGTGGAGTTGCAGCTGCCTCCCAAGGCTGCAGCCCTGGCTCACTTGGACAGGGGGAGCCCCCCACCTGCCCGGGAGGCACTGGCCATCGTCTTCTTTGGCAGGCAACCCCAGCCCAACGTGAGTGAGCTGGTGGTGGGGCCACTGCCTCACCCCTCCTACATGCGGGACGTGACTGTGGAGCGTCATGGAGGCCCCCTGCCCTATCACCGACGCCCCGTGCTGTTCCAAGAGTACCTGGACATAGACCAGATGATCTTCAACAGAGAGCTGCCCCAGGCTTCTGGGCTTCTCCACCACTGTTGCTTCTACAAGCACCGGGGACGGAACCTGGTGACAATGACCACGGCTCCCCGTGGTCTGCAATCAGGGGACCGGGCCACCTGGTTTGGCCTCTACTACAACATCTCGGGCGCTGGGTTCTTCCTGCACCACGTGGGCTTGGAGCTGCTAGTGAACCACAAGGCCCTTGACCCTGCCCGCTGGACTATCCAGAAGGTGTTCTATCAAGGCCGCTACTACGACAGCCTGGCCCAGCTGGAGGCCCAGTTTGAGGCCGGCCTGGTGAATGTGGTGCTGATCCCAGACAATGGCACAGGTGGGTCCTGGTCCCTGAAGTCCCCTGTGCCCCCGGGTCCAGCTCCCCCTCTACAGTTCTATCCCCAAGGCCCCCGCTTCAGTGTCCAGGGAAGTCGAGTGGCCTCCTCACTGTGGACTTTCTCCTTTGGCCTCGGAGCATTCAGTGGCCCAAGGATCTTTGACGTTCGCTTCCAAGGAGAAAGACTAGTTTATGAGATAAGCCTCCAAGAGGCCTTGGCCATCTATGGTGGAAATTCCCCAGCAGCAATGACGACCCGCTATGTGGATGGAGGCTTTGGCATGGGCAAGTACACCACGCCCCTGACCCGTGGGGTGGACTGCCCCTACTTGGCCACCTACGTGGACTGGCACTTCCTTTTGGAGTCCCAGGCCCCCAAGACAATACGTGATGCCTTTTGTGTGTTTGAACAGAACCAGGGCCTCCCCCTGCGGCGACACCACTCAGATCTCTACTCGCACTACTTTGGGGGTCTTGCGGAAACGGTGCTGGTCGTCAGATCTATGTCCACCTTGCTCAACTATGACTATGTGTGGGATACGGTCTTCCACCCCAGTGGGGCCATAGAAATACGATTCTATGCCACGGGCTACATCAGCTCGGCATTCCTCTTTGGTGCTACTGGGAAGTACGGGAACCAAGTGTCAGAGCACACCCTGGGCACGGTCCACACCCACAGCGCCCACTTCAAGGTGGATCTGGATGTAGCAGGACTGGAGAACTGGGTCTGGGCCGAGGATATGGTCTTTGTCCCCATGGCTGTGCCCTGGAGCCCTGAGCACCAGCTGCAGAGGCTGCAGGTGACCCGGAAGCTGCTGGAGATGGAGGAGCAGGCCGCCTTCCTCGTGGGAAGCGCCACCCCTCGCTACCTGTACCTGGCCAGCAACCACAGCAACAAGTGGGGTCACCCCCGGGGCTACCGCATCCAGATGCTCAGCTTTGCTGGAGAGCCGCTGCCCCAAAACAGCTCCATGGCGAGAGGCTTCAGCTGGGAGAGGTACCAGCTGGCTGTGACCCAGCGGAAGGAGGAGGAGCCCAGTAGCAGCAGCGTTTTCAATCAGAATGACCCTTGGGCCCCCACTGTGGATTTCAGTGACTTCATCAACAATGAGACCATTGCTGGAAAGGATTTGGTGGCCTGGGTGACAGCTGGTTTTCTGCATATCCCACATGCAGAGGACATTCCTAACACAGTGACTGTGGGGAACGGCGTGGGCTTCTTCCTCCGACCCTATAACTTCTTTGACGAAGACCCCTCCTTCTACTCTGCCGACTCCATCTACTTCCGAGGGGACCAGGATGCTGGGGCCTGCGAGGTCAACCCCCTAGCTTGCCTGCCCCAGGCTGCTGCCTGTGCCCCCGACCTCCCTGCCTTCTCCCACGGGGGCTTCTCTCACAACTAGGCGGTCCTGGGATGGGGCATGTGGCCAAGGGCTCCAGGGCCAGGGTGTGAGGGATGGGGAGCAGCTGGGCACTGGGCCGGCAGCCTGGTTCCCTCTTTCCTGTGCCAGGACTCTCTTTCTTCCACTACCCTCCCTCGCATCCGCCTCTGAGCCAGGAGCCTCCTGACCCTGTGATGCCTGACACAGGGGACACTGAACCTTGTTGATGCCAGCTGTACTGAGTTCTCATCCACAGAGGCCAGGCATGGCCCAGCCTGGAGCCGTGGCCGAGGGCTTCCCTAGATGGTTCCCTTTGTTGCTGTCTGGCTTTCCCGAATCTTTTTAGGCCACCTCCAAGGACTCTAAAAGGGGGCTATTCCCTGGAGACCCCAGAGTAGGGTTGCCAGTCCTGCAAGTCCATAGCTGAGCTGGAAAGGATGCTTCTGCTCACATTCCCTCTCATCCAGGTCCTTTCCTTCTCGTCTTCCTCTCTCTCACCTACTTCCTCCTCCTCCTCCTGTTCCTGCCTTCTCTTCTATCCTGCAATTTCTCCCGAATCCTGAGGGGATATCCCTATGTCCCAGCCCCTGGTACTCCCCCAGCCCTCAGTTTTCAGTCAAGTTCCGTCTCCTCTCCAGCCCTATGGAAGTCTCAAGGTCACGGGACCCCTAATCAGAGTGGCCAATCCCTGTGTGTCGTTCCCTTGTGTCTGTTGCTTATTGGGAGTAGGAGTTGCTCCTACCCCTGTCCTGGGGCTGGGTGTGTTTCAGGACAGCTGCTTCTGTGCATTTGTGTCTGCCTGCCTCATGCTCTCTATAGAGGAGGATGGTCATCGTGACAGCAGCAGCTCAAGTTAGCATTTCAAGTGATTTGGGGGTGCAATGATAATGAAGAATGGCCATTTTGTACCAGGGCTCTGTATTCTGCAACAGCCTGTTTGGGAGGCTGGAGTGGAAACAAAGGGTGGGCATCAAAGATGAGAAGCCAAAGCCCCTACAACTCCAGCCACCCAGCCAGGAGGGGCTGTCCAATCACATTCAGGCATGCGAATGAGCTGGGCCCTGGGTGAGGTGGGGGTCTGGCCTAGTGGGGAGGGGCCTGGCCTGGGTGGGGCAGGGCCTGGCCTGGTCCAGGCTTGGGCTCCATTCCCATCACTGCTGTCCCTCCTGAGGTCTGGATTGGGGATGGGGACAAAGAAATAGCAAGAGATGAGAAACAACAGAAACTTTTTTCTCTAAAGGACTGGTTAAATCAATTCTGATACAGCCTTACAATACAATAGTATGCAGCTAAAAAATAATTGTATGTCTTTATATACTAATATGTAATAATCTTCAGGTGAAAAAGGCAAGCCACAGAAATGTGTATAGCGCACTTCCCATTTGTGTTTCAGAAAGGAGTAGAATATAAACACATAATTGCTTATGTATGCCTATTCAGAATAAATGGGTAACACTGATTACTTTTGGGAGGGGAACCAGTAGGTTGAGGACAGGAGAGGGAAGGGTCTTAACACTTACACCCTTTTGTACATTTTGAATTTTGAACCATGTGACTGTATTACCTATTCAAAATAAACAATAAATGGGCCCAAACAGG