Transcript asmbl_6387

Sequence
Transcript Sequence for observation asmbl_6387 of TGE0056810:
CTCCAAATAGTTGGCAAATCCCAATCTGACCGAATTCAGGCCGGCCCCAGCCCCAACTTGTCCCTGATACCCCCACCATTCCTTATATCCTCCCCGACCCTCTCCCAGAGACCACCACTTCCCTCTCTGTCCTGTCTTGACAATTCCCCTTGACACTGCCAGTCACCCGCTGGGGGCAGTTCCGGGGAGGGAGGAGACTATGGCAAAGTTATCGGCCTCCAGGCCCTCTCACTCCCTTCCTGCGGCCGGCCAGGGGCGCCGGCCCGCCGCCCTCTCCACTCCCCGCCAGGCACGCAGCCACCTGGGCGAACTCACCGCGCTTTCAGCTCCTTAAACTCCTCACGCACTTTGCTCAGCTCCAGCTGCAGGCGGGCGCGCTCCTTGGCTACTGAGTCAAGGGTCTTGCGGGCATCCCCGAGCTCGGCCTCGTAGGCGGCCTTGATGCCGGACACCTCGCGGCTGACCACCTCTTCAGACTCGGTGATGCGAAGGCGCAGCCCTGCGTTCTCCGTTTCCAGCGAGCGCACACGGTCGATGTAGACCGCCAAGCGATCATTGAGCTCCTGCAGGTCCTCCTTCTCCTGCAGCCGGGTGATGCGGGTGGGCGACAGCGGAGTGGAGCTGGCCTGCGCCCCGCTGCGGGTGGCGCGCCGCTGGGACGGGGTCTCCATGGCCGGCAGGTTGGCAGCGCTGCCCGCGGGGCAGGGGTCCCGGAAAGGGCGCGGGGCTCGGGTCGAAGGACAGAGACTGCTCGGAGTCGGAGTGCGCCGGCCGGCTGGCTCTCGGCTTGCTCCTGGCAGGCGTGGGGATCTGGGCCGGGCGCTGTCGGACCTCGGGATCTGGGTTGGCTGGTGTAGGTGCGGCGCTCCCGCGAACACTGAGTCACCGACGCCGGGGCAAAGGCTCTAATAGGTCCTCCTCTGAAGGGAGGAGGGGCCACTACTCTTAAAGGGGCAGTCCCAGATCCATT