Transcript asmbl_63489

Sequence
Transcript Sequence for observation asmbl_63489 of TGE0056808:
GGTGCACTGTGGACGATGAGTCAGGGTTAGGGGCGCCAGGACGTGGGCGTGCAGGACGCCAGAGCTGGGTCAGAGCTCGAGCCAGCGGCGCCCGGAGAGATTCGGAGATGCAGGCGGCTCGGATGGCCGCGAGCTTGGGGCGGCAGCTGCTGAGGCTCGGGGGCGGAAGCTCGCGGCTCACGGCGCTCCTGGGGCAGCCCCGGCCCGGCCCTGCCCGGCGGCCCTATGCCGGGGGTGCCGCTCAGCTGGCTCTGGACAAGTCAGATTCCCACCCCTCTGACGCTCTGACCAGGAAAAAACCGGCCAAGGCGGAATCTAAGTCCTTTGCTGTGGGAATGTTCAAAGGCCAGCTCACCACAGATCAGGTGTTCCCATACCCGTCCGTGCTCAACGAAGAGCAGACACAGTTTCTTAAAGAGCTGGTGGAGCCTGTGTCCCGTTTCTTCGAGGAAGTGAACGATCCCGCCAAGAATGACGCTCTGGAGATGGTGGAGGAGACCACTTGGCAGGGCCTCAAGGAGCTGGGGGCCTTTGGTCTGCAAGTGCCCAGTGAGCTGGGTGGTGTGGGCCTTTGCAACACCCAGTACGCCCGTTTGGTGGAGATCGTGGGCATGCATGACCTTGGCGTGGGCATTACCCTGGGGGCCCATCAGAGCATCGGTTTCAAAGGCATCCTGCTCTTTGGCACAAAGGCCCAGAAAGAAAAATACCTCCCCAAGCTGGCATCTGGGGAGACTGTGGCCGCTTTCTGTCTAACCGAGCCCTCAAGCGGGTCAGATGCAGCCTCCATCCGAACCTCTGCTGTGCCCAGCCCCTGTGGAAAATACTATACCCTCAATGGAAGCAAGCTTTGGATCAGTAATGGGGGCCTAGCAGACATCTTCACGGTCTTTGCCAAGACACCAGTTACAGATCCAGCCACAGGAGCCGTGAAGGAGAAGATCACAGCTTTTGTGGTGGAGAGGGGCTTCGGGGGCATTACCCATGGGCCCCCTGAGAAGAAGATGGGCATCAAGGCTTCAAACACAGCAGAGGTGTTCTTTGATGGAGTACGGGTGCCATCGGAGAACGTGCTGGGTGAGGTTGGGAGTGGCTTCAAGGTTGCCATGCACATCCTCAACAATGGAAGGTTTGGCATGGCTGCGGCCCTGGCAGGTACCATGAGAGGCATCATTGCTAAGGCGGTAGATCATGCCACTAATCGTACCCAGTTTGGGGAGAAAATTCACAACTTTGGGCTGATCCAGGAGAAGCTGGCACGGATGGTTATGCTGCAGTATGTAACTGAGTCCATGGCTTACATGGTGAGTGCTAACATGGACCAGGGAGCCACGGACTTCCAGATAGAGGCCGCCATCAGCAAAATCTTTGGCTCGGAGGCAGCCTGGAAGGTGACAGATGAATGCATCCAAATCATGGGGGGTATGGGCTTCATGAAGGAACCTGGAGTAGAGCGTGTGCTCCGAGATCTTCGCATCTTCCGGATCTTTGAGGGGACAAATGACATTCTTCGGCTGTTTGTGGCTCTGCAGGGCTGTATGGACAAAGGAAAGGAGCTCTCTGGGCTTGGCAGTGCTCTAAAGAATCCCTTTGGGAATGCTGGCCTCCTGCTAGGAGAGGCAGGCAAACAGCTGAGGCGGCGGGCAGGGCTGGGCAGCGGCCTGAGTCTCAGCGGACTTGTCCACCCGGAGTTGAGTCGGAGTGGCGAGCTGGCAGTACGGGCTCTGGAGCAGTTTGCCACTGTGGTGGAGGCCAAGCTGATAAAACACAAGAAGGGGATTGTCAATGAACAGTTTCTGCTGCAGCGGCTGGCAGACGGGGCCATCGACCTCTATGCCATGGTGGTGGTTCTCTCGAGGGCCTCAAGATCCCTGAGTGAGGGCCACCCCACGGCCCAGCATGAGAAAATGCTCTGTGACACCTGGTGTATCGAGGCTGCAGCTCGGATCCGAGAGGGCATGGCCGCCCTGCAGTCTGACCCCTGGCAGCAAGAGCTCTACCGCAACTTCAAAAGCATCTCCAAGGCCTTGGTGGAGCGGGGTGGTGTGGTCACCAGCAACCCACTTGGCTTCTGAATACTCCCGGCCAGGGCCTGTCCCAGTTATGTGCCTTCCCTCAAGCCAAAGCCGAAGCCCCTTTCCTTAAGGCCCTGGTTTGTCCCGAAGGGGCCTAGTGTTCCCAGCACTGTGCCTGCTCTCAAGAGCACTTACTGCCTCGCAAATAATAAAAATTTCTAGCCAGT