Transcript asmbl_18368

Sequence
Transcript Sequence for observation asmbl_18368 of TGE0008337:
GCCGGGTGGAGGCCGGGAGGCGGTTGGGCCGGACCGAAGCGGCGCTGACGGAGCCGAGAATTATTGAGGGGAGAGGAGAGGAGAGGCCCAGCAGCCCGTCCGCGCGGCTCCGGGAGGAGGTGGAGGAGGCGGCCGAACGGGGCGGGGCGCCCGCTGCTTCCCGGCCGCAGCCATGGCCGACGAGACCCCCAGGAAGGGCAACTTCTCGGCGCTCGTCGGGCACACCAACGGCCTCACCAAGCCCGCGTCCCTCGCGGCGGCCGCCGTCACCTCCAAGCCAGGGGGCGGCGGCGGCTCCAAGAAACTAGTGATCAAGAATTTCCGAGACCGACCTAAATTGCCTGATAACTACACTCAGGACACCTGGCAGAAGCTTCATGAGGCAGTGAAAGCCATACAAAGTAGTACCTCCATCAGATACAACCTGGAAGAGCTCTACCAGGCTGTCGAAAATCTCTGTTCTCACAAAGTTTCCCCAACACTCTATAAGCAGCTACGCCAGGTTTGTGAAGATCATGTCCAAGCACAAATTCTTCAGTTTAGAGAAGACTCACTAGATAGTGTTTTATTTTTAAAGAAGATTAACACGTGCTGGCAAGATCATTGCAGACAAATGATCATGATCAGAAGCATTTTCCTGTTTTTGGATCGTACTTATGTACTTCAGAATTCCATGCTTCCTTCTATATGGGATATGGGATTAGAACTATTTAGGAACCATATTATTAGTGATAAAATGGTTCAGAGTAAAACTATTGATGGAATTCTGCTATTGATTGAACGAGAGAGAAGTGGTGAAGCGGTTGACCGAAGCTTGTTGCGGAGT