Transcript asmbl_47891

Sequence
Transcript Sequence for observation asmbl_47891 of TGE0000491:
GAGGGATTGCGGCGGCCCGCAGCGGGATAACCTTGAGGCTGAGGCAGTGGCTCCTTGCACAGCAGCTGCACGCGCCGTGGCTCCGGATCTCTTCGTCTTTGCAGCGTAGCCCGAGTCGGTCAGCGCCGGAGGACCTCAGCAGCCATGTCGAAGCCCCATAGTGAAGCCGGGACTGCCTTCATTCAGACCCAGCAGCTGCACGCAGCCATGGCTGACACATTCCTGGAGCACATGTGCCGCCTGGACATTGATTCACCACCCATCACAGCCCGGAACACTGGCATCATCTGTACCATTGGCCCAGCTTCCCGATCAGTGGAGACGTTGAAGGAGATGATTAAGTCTGGAATGAATGTGGCTCGTCTGAACTTCTCTCATGGAACTCATGAGTACCATGCGGAGACCATCAAGAATGTGCGCACAGCCACGGAAAGCTTTGCTTCTGACCCCATCCTCTACCGGCCCGTTGCTGTGGCTCTAGACACTAAAGGACCTGAGATCCGAACTGGGCTCATCAAGGGCAGCGGCACTGCAGAGGTGGAGCTGAAGAAGGGAGCCACTCTCAAAATCACGCTGGATAACGCCTACATGGAAAAGTGTGACGAGAACATCCTGTGGCTGGACTACAAGAACATCTGCAAGGTGGTGGAAGTGGGCAGCAAGATCTACGTGGATGATGGGCTTATTTCTCTCCAGGTGAAGCAGAAAGGTGCCGACTTCCTGGTGACGGAGGTGGAAAATGGTGGCTCCTTGGGCAGCAAGAAGGGTGTGAACCTTCCTGGGGCTGCTGTGGACTTGCCTGCTGTGTCGGAGAAGGACATCCAGGATCTGAAGTTTGGGGTCGAGCAGGATGTTGATATGGTGTTTGCGTCATTCATCCGCAAGGCATCTGATGTCCATGAAGTTAGGAAGGTCCTGGGAGAGAAGGGAAAGAACATCAAGATTATCAGCAAAATCGAGAATCATGAGGGGGTTCGGAGGTTTGATGAAATCCTGGAGGCCAGTGATGGGATCATGGTGGCTCGTGGTGATCTAGGCATTGAGATTCCTGCAGAGAAGGTCTTCCTTGCTCAGAAGATGATGATTGGACGGTGCAACCGAGCTGGGAAGCCTGTCATCTGTGCTACTCAGATGCTGGAGAGCATGATCAAGAAGCCCCGCCCCACTCGGGCTGAAGGCAGTGATGTGGCCAATGCAGTCCTGGATGGAGCCGACTGCATCATGCTGTCTGGAGAAACAGCCAAAGGGGACTATCCTCTGGAGGCTGTGCGCATGCAGCACCTGATTGCCCGTGAGGCAGAGGCTGCCATCTACCACTTGCAATTATTTGAGGAACTCCGCCGCCTGGCGCCCATTACCAGCGACCCCACAGAAGCCACCGCCGTGGGTGCCGTGGAGGCCTCCTTCAAGTGCTGCAGTGGGGCCATAATCGTCCTCACCAAGTCTGGCAGGTCTGCTCACCAGGTGGCCAGATACCGCCCACGTGCCCCCATCATTGCTGTGACCCGGAATCCCCAGACAGCTCGTCAGGCCCACCTGTACCGTGGCATCTTCCCTGTGCTGTGCAAGGACCCAGTCCAGGAGGCCTGGGCTGAGGACGTGGACCTCCGGGTGAACTTTGCCATGAATGTTGGCAAGGCCCGAGGCTTCTTCAAGAAGGGAGATGTGGTCATTGTGCTGACCGGATGGCGCCCTGGCTCCGGCTTCACCAACACCATGCGTGTTGTTCCTGTGCCGTGATGGACCCCAGAGCCCCTCCTCCAGCCCCTGTCCCACCCCCTTCCCCCAGCCCATCCATTAGGCCAGCAACGCTTGTAGAACTCACTCTGGGCTGTAACGTGGCACTGGTAGGTTGGGACACCAGGGAAGAAGATCAACGCCTCACTGAAACATGGCTGTGTTTGCAGCCTGCTCTAGTGGGACAGCCCAGAGCCTGGCTGCCCATCATGTGGCCCCACCCAATCAAGGGAAGAAGGAGGAATGCTGGACTGGAGGCCCCTGGAGCCAGATGGCAAGAGGGTGACAGCTTCCTTTCCTGTGTGTACTCTGTCCAGTTCCTTTAGAAAAAATGGATGCCCAGAGGACTCCCAACCCTGGCTTGGGGTCAAGAAACAGCCAGCAAGAGTTAGGGGCCTTAGGGCACTGGGCTGTTGTTCCATTGAAGCCGACTCTGGCCCTGGCCCTTACTTGCTTCTCTAGCTCTCTAGGCCTCTCCAGTTTGCACCTGTCCCCACCCTCCACTCAGCTGTCCTGCAGCAAACACTCCACCCTCCACCTTCCATTTTCCCCCACTACTGCAGCACCTCCAGGCCTGTTGCTATAGAGCCTACCTGTATGTCAATAAACAACAGCTGAAGCACC