Transcript asmbl_47631

Sequence
Transcript Sequence for observation asmbl_47631 of TGE0056538:
GGGTACTTTGCGCCGCGCTCTTCTGGCGGGGCCCGGGAGGCCGAGGGATCGGCCGGGGCTGCTGCCGCCGGGGGCCTGGGCTTTCCAGCCAGCTGTGGACCAAACGGTCTTCCCTTACCCAAATTAACTGCGCCACGCGCAGGCGGCGCACGGGTTGGGCTTGGGAATGGGGACCGCGAGGCTTCAGCATCCCGATGCCCTGAAAGTCTCCCCGCCTCGGGGATTTGTCTCTGTGTTGCAGCTGGCAGGGGCCGCCTGAAGTGGGAGCAGCGCCTGGAGAAGGCGGGAGGAGCCCGGCCCGGGGGACGGGCGGCGGGATAGCGGGACCCCGGCGGCGCGGTGCGCTTCAGGGCGCAGCGGCGGCCGCAGACCGAGCCCCGGGCGCGGCAAGAGGCGGCGGGAGCCGGTGGCGGCTCGGCATCATGCGTCGAGGGCGTCTGCTGGAGATCGCCCTGGGATTTACCGTGCTTTTAGCGTCCTACACGAGCCATGGGGCGGACGCCAATTTGGAGGCTGGGAACGTGAAGGAAACCAGAGCCAGTCGGGCCAAGAGAAGAGGCGGTGGAGGACACGACGCGCTTAAAGGACCCAATGTCTGTGGATCACGTTATAATGCTTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAAACGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTACACAGCTCTGACAAACGGGCGCTGCTCTAACCAGCTGCCACAGTCCATAACCAAAATGCAGTGCTGCTGTGATGCCGGCCGATGCTGGTCTCCAGGGGTCACTGTCGCCCCTGAGATGTGTCCCATCAGAGCAACCGAGGATTTCAACAAGCTGTGCTCTGTTCCTATGGTAATTCCTGGGAGACCAGAATATCCTCCCCCACCCCTTGGCCCCATTCCTCCAGTTCTCCCTGTTCCTCCTGGCTTTCCTCCTGGACCTCAAATTCCGGTCCCTCGACCACCAGTGGAATATCTGTATCCATCTCGGGAGCCACCAAGGGTGCTGCCAGTAAACGTTACTGATTACTGCCAGTTGGTCCGCTATCTCTGTCAAAATGGACGCTGCATTCCAACTCCTGGGAGTTACCGGTGTGAGTGCAACAAAGGGTTCCAGCTGGACCTCCGTGGGGAGTGTATTGATGTTGATGAATGTGAGAAAAACCCCTGTGCTGGTGGTGAGTGTATTAACAACCAGGGTTCGTACACCTGTCAGTGCCGAGCTGGATATCAGAGCACACTCACGCGGACAGAATGCCGAGACATTGATGAGTGTTTACAGAATGGCCGGATCTGCAATAATGGACGCTGCATCAACACAGATGGCAGTTTTCATTGCGTGTGTAATGCGGGCTTTCATGTTACACGAGATGGGAAGAACTGTGAAGATATGGATGAATGCAGCATAAGGAACATGTGCCTTAATGGAATGTGTATCAATGAAGATGGCAGTTTTAAATGTATTTGCAAACCTGGATTCCAGCTGGCATCAGATGGACGTTATTGCAAAGACATTAACGAGTGTGAAACCCCTGGGATCTGCATGAATGGGCGTTGCGTCAACACTGATGGCTCCTACAGATGTGAATGCTTCCCTGGACTGGCTGTGGGTCTGGATGGCCGTGTGTGTGTTGACACACACATGCGGAGCACATGCTATGGTGGATACAAGAGAGGCCAGTGTATCAAACCTTTGTTTGGTGCTGTCACTAAATCTGAATGCTGTTGCGCCAGCACTGAGTATGCATTTGGGGAACCTTGCCAGCCGTGTCCTGCACAGAATTCAGCGGAATATCAGGCACTCTGCAGCAGTGGGCCAGGAATGACGTCAGCAGGCAGTGATATAAATGAATGTGCACTAGATCCTGATATTTGCCCAAATGGAATCTGTGAAAACCTTCGTGGGACCTATAAATGTATATGCAATTCAGGATATGAAGTGGATTCAACTGGGAAAAACTGCGTTGATATTAATGAATGTGTACTGAACAGTCTCCTTTGTGACAATGGACAATGTAGAAATACTCCTGGAAGTTTTGTCTGTACCTGCCCCAAGGGATTTATCTACAAACCTGATCTAAAAACATGTGAAGACATTGATGAATGCGAATCAAGTCCTTGCATTAATGGAGTCTGCAAGAACAGCCCAGGCTCTTTTATTTGTGAATGTTCTTCTGAAAGTACTTTGGATCCAACAAAAACCATCTGCATAGAAACCATCAAGGGCACTTGCTGGCAGACTGTCATTGATGGGCGATGTGAGATCAACATCAATGGAGCCACCTTAAAGTCCCAGTGCTGCTCCTCCCTCGGTGCTGCGTGGGGAAGCCCGTGCACCCTATGCCAAGTTGATCCCATATGTGGTAAAGGGTACTCAAGAATTAAAGGAACACAATGTGAAGATATAGATGAATGTGAAGTGTTCCCAGGAGTGTGTAAAAATGGCCTGTGTGTTAACACTAGGGGGTCATTCAAGTGTCAGTGTCCCAGTGGAATGACTTTGGATGCCACAGGAAGGATCTGTCTTGATATCCGCCTGGAAACCTGCTTCCTGAGGTACGAGGACGAGGAGTGCACCCTGCCTATTGCTGGCCGCCACCGCATGGACGCCTGCTGCTGCTCCGTCGGGGCAGCCTGGGGTACTGAGGAATGCGAGGAGTGTCCCATGAGAAATACTCCTGAGTACGAGGAGCTGTGTCCGAGAGGACCCGGATTTGCCACAAAAGAAATTACAAATGGAAAGCCTTTCTTCAAAGATATCAATGAGTGCAAGATGATACCCAGCCTCTGCACCCACGGCAAGTGCAGAAACACCATTGGCAGCTTTAAGTGCAGGTGTGACAGCGGCTTTGCTCTTGATTCTGAAGAAAGGAACTGCACAGACATTGACGAATGCCGCATATCTCCTGACCTCTGTGGCAGAGGCCAGTGTGTGAACACCCCTGGGGACTTTGAATGCAAGTGTGACGAAGGCTATGAAAGTGGATTCATGATGATGAAGAACTGCATGGATATTGATGAGTGTCAGAGAGATCCTCTCCTATGCCGAGGTGGTGTTTGCCATAACACAGAGGGAAGTTACCGCTGTGAATGCCCGCCTGGCCATCAGCTGTCCCCCAACATCTCCGCGTGTATCGACATCAATGAATGTGAGCTGAGTGCACACCTGTGCCCCAATGGCCGTTGCGTGAACCTCATAGGGAAGTATCAGTGTGCCTGCAACCCTGGCTACCATTCAACTCCCGATAGGCTATTTTGTGTTGACATTGATGAATGCAGCATAATGAATGGTGGTTGTGAAACCTTCTGCACAAACTCTGAAGGCAGCTATGAATGTAGCTGTCAGCCGGGATTTGCACTAATGCCTGACCAGAGATCATGCACCGACATCGATGAGTGTGAAGATAATCCCAATATCTGTGATGGTGGTCAGTGCACAAATATCCCTGGAGAGTACAGGTGCTTGTGTTATGATGGATTCATGGCATCTGAAGACATGAAGACTTGTGTAGATGTCAATGAGTGTGACCTGAATCCAAATATCTGCCTAAGTGGGACCTGTGAAAACACGAAAGGCTCATTTATCTGCCACTGTGATATGGGCTACTCCGGCAAAAAAGGAAAAACTGGCTGTACAGACATCAATGAATGTGAAATTGGAGCACACAACTGTGGCAAACATGCTGTATGTACCAATACAGCAGGAAGCTTCAAATGTAGCTGCAGTCCCGGGTGGATTGGAGATGGCATTAAGTGCACTGATCTGGACGAATGTTCCAATGGAACCCATATGTGCAGCCAGCATGCAGACTGCAAGAATACCATGGGATCTTACCGCTGTCTGTGCAAGGAAGGATACACAGGTGATGGCTTCACTTGTACAGACCTTGATGAGTGCTCTGAGAACCTGAATCTCTGTGGCAATGGCCAGTGCCTCAATGCACCAGGAGGATACCGCTGTGAATGCGACATGGGCTTCGTGCCCAGTGCTGACGGGAAAGCCTGTGAAGATATTGATGAGTGCTCCCTTCCGAACATCTGTGTCTTTGGAACTTGCCACAACCTCCCTGGCCTGTTCCGCTGTGAGTGTGAGATAGGCTACGAACTGGACAGAAGCGGCGGGAACTGCACAGATGTGAATGAATGCCTGGATCCAACCACGTGCATCAGTGGGAACTGTGTCAACACTCCAGGCAGCTATATCTGTGACTGCCCACCTGATTTTGAACTGAACCCAACTCGAGTTGGCTGTGTTGATACCCGCTCTGGAAATTGCTATTTGGATATTCGACCTCGAGGAGACAATGGAGATACAGCCTGCAGCAATGAAATTGGAGTTGGTGTTTCCAAAGCTTCCTGCTGCTGTTCTCTGGGTAAAGCCTGGGGTACTCCTTGTGAGATGTGTCCTGCTGTGAACACATCCGAGTACAAAATTCTTTGTCCTGGAGGGGAAGGTTTCCGACCAAATCCTATCACCGTTATATTGGAAGATATTGATGAGTGCCAGGAGCTACCAGGGCTGTGCCAAGGAGGAAAATGTATCAACACCTTTGGGAGTTTCCAGTGCCGCTGTCCAACCGGCTACTACCTGAATGAAGATACACGAGTGTGTGATGATGTGAATGAATGTGAGACTCCTGGAATCTGTGGTCCAGGGACATGTTACAACACCGTTGGCAACTACACCTGTATCTGTCCTCCAGACTACATGCAAGTGAATGGGGGAAATAATTGCATGGATATGAGAAGAAGTTTGTGCTACAGAAACTACTATGCTGACAACCAGACCTGTGATGGAGAATTGTTATTCAACATGACCAAGAAGATGTGCTGCTGTTCCTACAACATTGGCCGGGCGTGGAACAAGCCCTGTGAACAGTGTCCCATCCCAAGTACAGATGAGTTTGCTACACTCTGTGGAAGTCAAAGGCCAGGCTTTGTCATCGACATTTATACCGGTTTACCCGTTGATATTGATGAGTGCCGGGAGATCCCAGGGGTCTGTGAAAATGGAGTGTGTATCAACATGGTTGGCAGCTTCCGATGTGAATGTCCAGTGGGATTCTTCTATAATGACAAGTTGTTGGTTTGTGAAGATATTGACGAGTGTCAGAACGGCCCAGTGTGCCAGCGCAACGCCGAATGCATCAACACTGCAGGCAGCTACCGCTGTGACTGTAAGCCCGGCTACCGCTTCACCTCCACAGGACAGTGCAATGATCGTAATGAATGTCAAGAAATCCCCAATATATGCAGTCATGGGCAGTGCATTGACACAGTTGGAAGCTTTTATTGCCTTTGCCACACTGGTTTTAAAACAAATGATGACCAAACCATGTGCTTGGACATAAATGAATGTGAAAGAGATGCCTGTGGGAATGGAACTTGCCGGAACACAATTGGTTCCTTCAACTGCCGCTGCAATCATGGTTTCATCCTTTCTCACAACAATGACTGTATAGATGTTGATGAATGTGCAAGTGGAAATGGGAATCTTTGCAGAAATGGCCAATGCATTAATACAGTGGGGTCTTTCCAGTGCCAGTGCAATGAAGGCTATGAGGTGGCTCCAGATGGGAGGACCTGTGTGGATATCAATGAATGTCTTCTAGAACCCAGAAAATGTGCACCAGGTACCTGTCAAAACTTGGATGGGTCCTACAGATGCATTTGCCCACCTGGATACAGTCTTCAAAATGAGAAGTGTGAAGATATTGATGAGTGTGTCGAAGAGCCAGAAATTTGTGCCCTGGGCACATGCAGTAACACTGAAGGCAGCTTCAAATGTCTGTGTCCAGAAGGGTTTTCCTTGTCCTCCAGTGGAAGAAGGTGCCAAGATTTGCGAATGAGCTACTGTTATGCGAAGTTTGAAGGAGGAAAGTGTTCATCACCCAAATCCAGAAATCACTCCAAGCAGGAATGCTGCTGTGCCTTGAAGGGAGAAGGCTGGGGAGACCCCTGCGAGCTCTGCCCCACGGAACCTGATGAGGCCTTCCGCCAGATATGTCCTTATGGAAGTGGGATCATCGTGGGACCTGATGATTCAGCAGTTGATATGGACGAATGCAAAGAACCCGATGTCTGTAAACATGGACAGTGCATCAATACAGATGGTTCCTATCGCTGCGAGTGTCCCTTTGGTTATATTCTAGCAGGGAATGAATGTGTAGATACTGATGAATGTTCTGTTGGCAATCCTTGTGGAAATGGAACCTGCAAGAATGTGATTGGAGGTTTTGAATGCACCTGCGAGGAGGGATTTGAGCCCGGTCCAATGATGACATGTGAAGATATAAATGAATGTGCCCAGAATCCTCTGCTCTGTGCCTTCCGATGTGTGAACACTTATGGGTCATATGAATGCAAATGTCCCGTGGGATATGTGCTCAGAGAAGACCGTAGGATGTGCAAAGATGAGGATGAGTGTGAAGAGGGAAAACATGACTGTACTGAAAAACAAATGGAATGCAAGAACCTCATTGGCACATATATGTGCATCTGTGGACCCGGGTATCAGCGGAGACCTGATGGAGAAGGCTGTGTAGATGAGAATGAATGTCAGACGAAGCCAGGGATCTGTGAGAATGGGCGCTGCCTCAACACCCGTGGGAGCTACACCTGTGAGTGTAATGATGGGTTTACCGCCAGCCCCAACCAGGACGAGTGCCTTGACAATCGGGAAGGGTACTGCTTCACAGAGGTGCTACAAAACATGTGTCAGATCGGCTCCAGCAACAGGAACCCCGTCACCAAATCGGAATGCTGCTGTGACGGAGGGAGAGGCTGGGGTCCCCACTGTGAGATCTGCCCTTTCCAGGGGACTGTGGCTTTCAAGAAACTCTGTCCCCATGGCCGAGGATTCATGACCAATGGAGCAGATATCGATGAATGCAAGGTTATTCACGATGTTTGCCGAAATGGGGAATGTGTCAATGACAGAGGATCATATCATTGCATTTGTAAAACTGGGTACACTCCAGATATAACTGGGACTTCCTGTGTAGATCTGAACGAGTGCAACCAGGCTCCCAAACCCTGCAATTTTATCTGCAAAAACACAGAAGGGAGTTACCAGTGTTCATGCCCGAAAGGCTACATTCTGCAAGAGGATGGAAGGAGCTGCAAAGATCTTGATGAGTGTGCAACCAAGCAACACAACTGCCAGTTCCTATGTGTTAACACCATTGGCGGCTTCACATGCAAATGTCCTCCCGGATTTACCCAACACCATACGTCCTGCATTGATAACAATGAATGCACCTCTGACATCAATCTGTGCGGGTCTAAGGGCATTTGCCAGAACACTCCTGGAAGCTTCACCTGTGAATGCCAGCGGGGATTCTCACTTGATCAGACCGGCTCCAGCTGTGAAGACGTGGACGAGTGTGAGGGTAACCACCGCTGCCAGCATGGCTGCCAGAACATCATTGGGGGCTACAGGTGCAGCTGCCCCCAGGGCTACCTCCAGCACTACCAGTGGAACCAGTGTGTTGATGAAAACGAATGCCTCAGCGCTCACATCTGCGGAGGAGCCTCCTGTCACAACACCCTGGGGAGCTACAAGTGCATGTGTCCCGCCGGCTTCCAGTATGAACAGTTCAGTGGAGGATGCCAAGACATCAATGAATGTGGCTCTGCGCAGGCCCCCTGCAGCTATGGCTGTTCCAATACCGAGGGCGGTTACCTGTGTGGCTGTCCACCTGGTTACTTCCGCATAGGCCAAGGGCACTGTGTTTCTGGAATGGGCATGGGCCGAGGAAACCCAGAGCCACCTGTCAGTGGTGAAATGGATGACAATTCACTCTCCCCAGAGGCTTGTTACGAGTGTAAGATCAATGGCTACCCCAAACGGGGCAGGAAACGGAGAAGCACAAACGAAACTGATGCCTCCAATATCGAGGATCAGTCTGAGACAGAAGCCAATGTGAGTCTTGCAAGTTGGGATGTTGAGAAGACAGCCATCTTTGCTTTCAATATTTCCCACGTCAGTAACAAGGTTCGAATCCTAGAACTCCTTCCAGCTCTTACAACTCTGACGAATCACAACAGATACTTGATCGAATCTGGAAATGAAGATGGCTTCTTTAAAATCAACCAAAAGGAAGGGATCAGCTACCTCCACTTCACAAAGAAGAAGCCAGTGGCTGGAACCTATTCATTACAAATCAGTAGTACTCCACTTTATAAAAAGAAAGAACTTAACCAACTAGAAGACAAATATGACAAAGACTACCTCAGTGGTGAACTGGGTGATAATCTGAAGATGAAAATCCAGGTTTTGCTTCATTAATTCACCATCCAGAGACCAAATAATTAAAAGAAAAACAAATATAGATAGGTAGAACTATATTTTCCCCCAATCAGAATCATCATATCATAGGTACAATCTTTCACCAAGTAAATTTGTATAAATAAGCACTATTCTTTGTATTACCAAAGCAAGGTACAGGTGACTACCCTAGTTCAAAACAACCACTTTCTCAGGCTTCTCATGTGTGTAGCTAAGCTACCTTGTCATATGTGTTGATTCTTGAAAACTGGGACGTGTATTTCCATTGGGGGTTGGCCATTTATGCTGACATGCCATCCTTCCAGCAAACGTACGGGAATGTGCTTTCAATTGATGGACTACTCTATTTTTTGCAAATTTGTAAACTTTGCTTCTCCAAATACAAGTACTAGGTTGTCCATTTATGGTACCTATTTGGTGCTAGTAAATTTTCAAACTAGATTTATAAATGCACTGTAATATGTACACAACTTAGAAACCAAATTACAAGTATTCAGTTCCAATACTTCATTAATTTCAATCAACCAAAGTTAGTTCAGTAGCTTATCTCAGTTATGAGTATAATACATTACATGTAAATTAAGTGTGTGTATACTGTAATCGTGCTATTTTTTATCATTGAAACATTTATAAACTAGAATAATAATGCCCTTAATGTGAGGGTTTGTAATGGTGCTTATTAAGACCAAAGACTTGTTAAATGTATACACCAAGTGGTAATGAAATTTCGGTGACTGGCCCACACGTGCATAGAGGTCTGGGAGGACCAGGAAACAGCCTCAGTGGCCAGAGGATCACCAGTGCATCCTTCATCACAGCATGTGCAATATGCCAAGATTACCCTCGGTCATTCCTGTCAACAAGGGGTCAATGTCATAAATGTCACAATAAAACAATCTCTTCTTTTTTTTAGTTTACCCCTTGGCTTTGTGTTCTTGCATGGATTTGGGGTTGGAGGGGCCATTCCGGAGGCTAAATAAAGTCTCCTGGATTTAAATTATCCTGGGTCTCTTACTTATGGCTTATGAAAGTACCAAATGTATAACCACTAGAAGAAAATTTAACATATGAGTCGATCCCTTGTTTTATCCATTGAAAGTAGCAGAGTCTGGTGTCATTAACCTGACTTGCTTGTGAGAAATTTAGATTGTAGAGTCATTTCTGAAACATGACCTAATTCATCTTGTGACTTTTAAATAGTCTTAAATACCAAGTTCAGTCATTGTCTTAGAGCACATGAATTTCATTATAATAGATTTATCATGCCCCCCTCTCAAATATACACAGTTTTGGCAAGCCTTAGGTGTTCTGTTCCATTTTTTTTTCCCCTAAACATCTTTCGTTAGTCAATGCTCATCTAATTACAAAGGGATAATCCCAGACTGTATCCAATTGCTGTAACTTTTGGTTTCTTAATGTCATAATTTTTAAAGTCTGTTTTATTTTAAGTGCAATATTGAGTATTTAGCTGTTAGGCTCAATCCGTCGATATGAAATAATTTTTTAAATCCCTAAGGGCAGGAAAGCATTTCGTGGTAGTGAAAATAAGAGGAAATAAGATGGCATGAAGGTGGTGGGCGGAGAAACTAGGTAGGACACAGGAAAGTGCTCTCAAAAATCTTTGAAGAGCTCAGCTGAAAAAAATGGAGTAGATTTGGCTCATACTATTCCGGAAGGCAAAACCAGGGTCAGCTGATGTCAGCCCCAGTTTAATACACACGGTCCCAATTATAGAGCTACTCACTGAAAGAATGGGTTTCCTTGCATTGTGGTGAGCTCCCTGTCACAAGATAGAAGAGTTTCAGTCTAGGCTTAATGGCAACCATTGGACAAAGATGCTTTCTTCCACCTAACAGGCCATTAACATCTTAAAGGTATTTTTGTATCTCTAATTTTGTTTATAATAGGTGCTCAACAGAATGAGCTGAATGGCTGTTACAAAGGGGGTTTGTACCTTGGGTAAGAGATTAAAATATAACTCAAAATTTCCTTCTAACGCTGCACCTATGGAACCATGTGATAGAGGTGTATTAAAATTGTTATCGAAGAATATATAGCATATGGTAAACAACAGTTTGCATATGGAAAATGTCTTTGATAATTTAACCAGAACTGCATTATATTCAATAACGGATTTTCTTTATAACAAACAACAGGGGAAAATGGAGTTGGCACACAGTGGATCACTTTGATATTTTTAATAGTCCAAGTCTGGATTTTATTTATTCCTGAGCCAACAATTTTGAACAGCATATTTTCCATGTTTCTGACTGTAACAAAACATTTTCCTCATTGTTCCATTGTAAATATTCCTCTTGTTGGAACTCTTTTTAATCCTGAGATTTAAACCTGTACCTTTCAATTGTCTGTGACCTTTCAATTTCACTTTCAATAGTTGAAGAACTTGGCTTTGTAAATCTCTCAGAAGCTTGAAAATATCTTGTCTCTACCCCCTCAGCCCATTTCATTTGCCAATAATTATTTTGTAAGTAGGGTTGAAATGAACTCAGCTGGCCTTGTGAAATGTTTAAACTTGCACAAACAACTACATTTTTGTTCAACAAATAGCAGTTTACTCAGCCAAAATCACTTTGGATATTGCCATTACAAATACTGTTAAACTTCAGAAATCATGTCTGTAAATTAGATGAGCCAAAATAAAGGACAATTGGGTTGATGCTG