Transcript asmbl_46792

Sequence
Transcript Sequence for observation asmbl_46792 of TGE0056208:
TCGAGGCTGGCGCGGCGCGGAGAGTGGGCTGGAGGCCGGGGCGGGACGCGTTGTGCAGCGGGTAAGCGCACGGCCGAGCGAGCATGGAGGGGGACCGGGTGGCCGGGCGGCCGGTGCTGTCGTCGTTACCAGTGCTACTGCTGCTGCCGTTGCTAATGTTGCGGGCCGCGGCGCTGCACCCAGACGAGCTCTTCCCACACGGGGAGTCGTGGGGGGACCAGCTCCTGCAGGAAGGCGACGACGAAAGCTCAGCCGTGGTGAAGCTGGCGAATCCCCTGCACTTCTACGAAGCCCGATTCAGCAACCTCTACGTGGGCACCAACGGCATCATCTCCACTCAGGACTTCCCCAGGGAAACGCAGTATGTGGACTATGATTTCCCCACCGACTTCCCGGCCATCGCCCCTTTTCTGGCGGACATCGACACGAGCCACGGCAGAGGCCGAGTCCTGTACCGAGAGGACACCTCCCCCGCAGTGCTGGGCCTGGCCGCCCGCTATGTGCGCGCTGGCTTCCCGCGCTCTGCGCGCTTTACCCCCACCCACGCCTTCCTGGCCACCTGGGAGCAGGTAGGCGCTTACGAGGAGGTCAAGCGCGGGGCGCTGCCCTCGGGAGAGCTGAACACTTTCCAGGCAGTTTTGGCATCTGATGGGTCTGATAGCTACGCCCTCTTTCTTTATCCTGCCAACGGCCTGCAGTTCCTTGGAACCCGCCCCAAAGAGTCTTACAATGTCCAGCTTCAGCTTCCAGCTCGGGTGGGCTTCTGCCGAGGGGAGGCTGATGATCTGAAGTCAGAAGGACCATATTTCAGCTTGACTAGCACTGAACAGTCTGTGAAAAATCTCTATCAACTAAGCAACCTGGGGATCCCTGGAGTGTGGGCTTTCCATATCGGCAGCACTTCCCCGTTGGACAATGTCAGGCCAGCTGCAGTTGGAGACCTTTCCGCTGCCCACTCTTCTGTTCCCCTGGGACGTTCCTTCAGCCATGCTACAGCCCTGGAAAGTGACTATAATGAGGACAATTTGGATTACTATGATGTGAATGAGGAGGAAGCTGAATACCTTCCGGGTGAACCAGAGGAGGCATTGAATGGCCACAGCAGCATTGATGTTTCCTTCCAATCCAAAGTGGATACAAAGCCTTTAGAGGAATCTTCCACCTTGGATCCTCACACCAAAGAAGGAACATCTCTGGGAGAGGTAGGGGGCCCAGATTTAAAAGGCCAAGTTGAGCCCTGGGATGAGAGAGAGACCAGAAGCCCAGCTCCACCAGAGGTAGACAGAGATTCACTGGCTCCTTCCTGGGAAACCCCACCACCGTACCCCGAAAACGGAAGCATCCAGCCCTACCCAGATGGAGGGCCAGTGCCTTCGGAAATGGATGTTCCCCCAGCTCATCCTGAAGAAGAAATTGTTCTTCGAAGTTACCCTGCTTCAGGTCACACTACACCCTTAAGTCGAGGGACGTATGAGGTGGGACTGGAAGACAACATAGGTTCCAACACCGAGGTCTTCACGTATAATGCTGCCAACAAGGAAACCTGTGAACACAACCACAGACAATGCTCCCGGCATGCCTTCTGCACGGACTATGCCACTGGCTTCTGCTGCCACTGCCAATCCAAGTTTTATGGAAATGGGAAGCACTGTCTGCCTGAAGGGGCACCTCACCGAGTGAATGGGAAAGTGAGTGGCCACCTCCACGTGGGCCATACACCCGTGCACTTCACTGATGTGGACCTGCATGCGTATATCGTGGGCAATGATGGCAGAGCCTACACGGCCATCAGCCACATCCCACAGCCAGCAGCCCAGGCCCTCCTCCCCCTCACACCAATTGGAGGCCTGTTTGGCTGGCTCTTTGCTTTAGAAAAACCTGGCTCTGAGAACGGCTTCAGCCTCGCAGGTGCTGCCTTTACCCATGACATGGAAGTTACATTCTACCCGGGAGAGGAGACGGTTCGTATCACTCAAACTGCTGAGGGACTTGACCCAGAGAACTACCTGAGCATTAAGACCAACATTCAAGGCCAGGTGCCTTACGTCTCAGCAAATTTCACAGCCCACATCTCTCCCTACAAGGAGCTGTACCACTACTCCGACTCCACTGTGACCTCTACAAGTTCCAGAGACTACTCTCTGACTTTTGGTGCAATCAACCAAACATGGTCCTACCGCATCCACCAGAACATCACTTACCAGGTGTGCAGGCACGCCCCCAGACACCCGTCCTTCCCCACCACCCAGCAGCTGAACGTGGACCGGGTCTTTGCCTTGTATAATGACGAAGAAAGAGTGCTTAGATTTGCTGTGACCAATCAAATTGGCCCGGTCAAAGAGGATTCAGACCCCACTCCGGGGAATCCTTGCTATGATGGGAGCCACATGTGTGACACAACAGCACGGTGCCATCCAGGGACAGGTGTAGATTACACCTGTGAGTGCGCATCTGGGTACCAGGGAGATGGACGGAACTGTGTGGATGAAAATGAATGTGCAACTGGCTTTCATCGCTGTGGCCCCAACTCTGTATGTATCAACTTGCCTGGAAGCTACAGGTGTGAGTGCCGGAGTGGTTATGAGTTTGCAGATGACCGGCATACTTGCATCTTGATCACCCCACCTGCCAACCCCTGTGAGGATGGCAGTCATACCTGTGCTCCTGCTGGGCAGGCCCGGTGTGTTCACCATGGAGGCAGCACGTTCAGCTGTGCCTGCCTGCCTGGTTATGCCGGCGATGGGCACCAGTGCACTGATGTAGATGAATGCTCAGAAAACAGATGTCACCCTGCAGCTACCTGCTACAATACTCCTGGTTCCTTCTCCTGCCGTTGTCAACCCGGATATTATGGGGATGGATTTCAGTGCATACCTGACTCCACCTCAAGCCTGACACCCTGTGAACAACAGCAGCGCCATGCCCAGGCCCAGTATGCCTACCCTGGGGCCCGGTTCCACATCCCCCAATGCGACGAGCAGGGCAACTTCCTGCCCCTACAGTGTCATGGCAGCACTGGTTTCTGCTGGTGCGTGGACCCTGATGGTCATGAAGTTCCTGGTACCCAGACTCCACCTGGCTCCACCCCGCCTCACTGTGGACCATCACCAGAGCCCACCCAGAGGCCCCCGACCATCTGTGAGCGCTGGAGGGAAAACCTGCTGGAGCACTACGGTGGCACCCCCCGGGATGACCAGTACGTGCCCCAGTGCGATGACCTGGGCCACTTCATCCCCCTGCAGTGCCACGGAAAGAGCGACTTCTGCTGGTGTGTGGACAAAGATGGCAGAGAGGTGCAGGGCACCCGCTCCCAGCCAGGCACCACCCCTGCGTGTATACCCACCGTCGCTCCACCCATGGTCCGGCCCACGCCCCGGCCAGATGTGACCCCTCCATCTGTGGGCACCTTCCTGCTCTATACTCAGGGCCAGCAGATTGGCTACTTACCCCTCAATGGCACCAGGCTTCAGAAGGATGCAGCTAAGACCCTGCTGTCTCTGCATGGCTCCATAATCGTGGGAATTGATTACGACTGCCGGGAGAGGATGGTGTACTGGACAGATGTTGCTGGACGGACAATCAGCCGTGCTGGTCTGGAACTGGGAGCAGAGCCTGAGACGATCGTGAATTCAGGTCTGATAAGCCCTGAAGGACTTGCCATAGACCACATCCGCAGAACAATGTACTGGACGGACAGTGTCCTGGATAAGATAGAGAGCGCCCTGCTGGATGGCTCTGAGCGCAAGGTCCTCTTCTACACAGATCTGGTGAATCCCCGTGCCATCGCTGTGGATCCAATCCGAGGCAACTTGTACTGGACAGACTGGAATAGAGAAGCTCCTAAAATTGAAACGTCATCTTTAGATGGAGAAAACAGAAGAATTCTGATCAATACAGACATTGGATTGCCCAATGGCTTAACCTTTGACCCTTTCTCTAAACTGCTCTGCTGGGCAGATGCAGGAACCAAAAAACTGGAGTGTACACTACCTGATGGAACTGGACGGCGTGTCATTCAAAACAACCTCAAGTACCCCTTCAGCATCGTAAGCTATGCAGATCACTTCTACCACACAGACTGGAGGAGGGATGGTGTTGTATCAGTAAATAAACATAGTGGCCAGTTTACTGATGAGTATCTCCCAGAACAACGATCTCACCTCTACGGGATAACTGCAGTCTACCCCTACTGCCCAACAGGAAGAAAGTAAGTACAGTAATGTAAAGGAAGACTTGGAGTTTACAATCAGAACCTGGACCCTAAAGAACAGTGACTGCAAAGGCAAAGAAAGTAAAAAAGGAATTGGCCATTAGACGTTCCTGAGCATCCAAGATGAACATTTTGTAGTGCAAAAAGACTTTTGTGAAAAGCTGATACCTCAATCTTTACTACTGTATTTTTAAAAATGAAGGTTGTTATTGCAAGTTTAAAAAGGTAACAGAATTTTAACTGTTGCTTATTAAAGCAACTTCTTGTAAACATTTATCATTAATATTTAAAAGATCAAATTCATTCAACTAAGAATTAGAGTTTAAGACTCTAAACCTGATTTTTGCCATGGATTCCTTCTGGCCAAGAAATTAAAGCACATGTGATCAATATAACAATATAATCCTAAACCTTGACAGTTGGAGAAGCCAATGCAGAACTGATGGGAAAGGACCAATTATTTATAGTTTCCCAACAAAAGTTCTAAGATTTTTTACCTCTGCATCAGTGCATTTCTATTTATATCAAAAGGTGCTAAAATGATTCAATTTGCATTTTCTGATCCTGTAGTGCCTCTATAGAAGTACCCACAGAAAGTAAAGTATCACATTTATAAATACCAAAGATGTAACAATTTTAAAATTTTCTAGATTACTCCAATAAAGTGTTTTAAGTTTTCCTATGACTTAAGGATCTATATTGTCTCTAGGACAAAGCTGGGGGTTGGCATATATGCCTTAACCACAAAGGAGAAAGGTGATTTATGCAAACATACAGTACATAATAAAAATTCTACTTTCCTAAACTTTATTAAAGAAAAAAGCAATAAGCAATGGTGGTAAATCTCTAGAACATACCCAATTTTCTGGGCTTCCTCCCCCGAGAATGTGACATTTTGATTTCCAAACATGCCAGAAGTGTATGGTTCCCAACTGTACTAAGTAGGTGAGAAGCTGAAGTCCTCAAGTGTTCATCTTCCAACTTTTCCCAGTCTGTGGTCTGTCTTTGGATCAGCAATAATTGCCTGAACAGCTACTATGGCTTCGTTGATTTTTGTCTGTAGCTCTCTGAGCTCCTCTATGTGCAGCAATCGCAGAATTTGAGCAGCTTCATTAAGAACTGCATCTGTTTTATGAGAAAAGAACACTGCTTCAATACATAATTTTTACATTTAAGGCCATTTATTTCCTCCCAAGTATTCAGTCTGTAAAAAAAATAGTTTGAATTTAAACAAAATCACTTACCTCCTGTGTCAAAACCAAGAATATGTTTGTCTAAAGCAACAGGTAAGCCCTTTAAAAAAAGAAAGACAAAATGAGAGTATTTATGGTTAAGAATAGCATCCTTTCCTCAACTGAAACTGAAAAGCACCTAGCTATTCTGGTGTCTTAACTCTTTTAGCTGCATGGGCAAGGGAACTAGGAATTTTGTTTATATTTGCTTTGTGATGATTGTGATTAGCGAGTTTTCCCTATTTCAACCGGTTAGGGGGAAAAGTTAACCTTTAAATGTACCAGGAAGCTCTATAGCTCATCCAATCCTTTAGCCCAGGCATACAAAACAATATATCCTTATTGCAGCAGTGCCTTGTCATTACTGCTATGGAAGGCAAGTTGAGCCAGGCTGTTACTGTCTTATTTTGGCGACAGTAAGCAACAGTATAAACGGCAAAAATAGTACCTTATATTCCATTTCTGAGCACATTAATTTGTCTTTACAAATTGTACGAACCTTTCAGCCAGCATGGTGTTTGCCAAGATTATGTATAATTATGTATAATTTAACTTTCAAGACTTGACTTGGAAGTTACTTTGAAACAAACAGTCTAGGAAAATGAAAAACTAAACCACTCAGCACCTATGGACATACTAAAGATGGTGACTATGGTGATGCCAAACTTCACAGAAACAAATTCTAAAATGAGGACAGTCTGTACTTCCTGCTGATTATATAAAATCACTGCCAAGAAAAACACACTACCCGTACTTTCAATCTTTCAATGTTACAACCTGTTACTATTCAAATGCTTTAGTCACTGCTCAATTCTTGCCTTATCTAGTAATGTAAATCTACGTAGGCTCTGTCTGCTTTAAAACAGCTAACACATGTAAGTCTGAAGAAACCAATGGGTACGAAAGCACAAGTGAGCAAAATTAAAGAGCAGAATTGTACTGAGTGGCTTTATATGTTCATCTAGTACCAGAGGCTCCACTTTTTTTTCCTTTGCCAACAGGCCACCAAGCTACCCCTGAAAACTACCATATGCCTCAAATAGTAGTTATAAATGCTTATAAGTACACTAGACTGTAAGAACTCCACTAAATTGTTATAGGCTGGTATCTTTTGAGATGACACCAAAATTAAAATTGGGAGCATTAAAAATAAAACTAAATTTTACTTTACAAACAAGAGCAAAGAGATTTGGCTAAGCCTTTACTTACACTGCCTTCCAAAGCATAGTTTTGCTGAAGGAATGAATGAATGAATGATTGACTTTATTACACCAGAACAATTTACTGTCTGTTCTATAGGGAGGGTGAAATAAGCTGATCTTTAACCCAACTTCCAGTGGCTCGATTCATATACAACGAGCCAGTAAGAACCTTTAAAAGAAAACAGTGTCTTTCAGAGATACTGCCCTGGCATTAGTAACCTTTTAACACTGCTTGGCCTGCCTAAAGGGGCTGGAGGACAAAAGGCATTGGGAGATGGGGGAAGGGCGCAGGGAGGACAAACAACATAGTTGTGCCCAAGGCATTCACTACAACATCATTGCTGCAGGAGGCAGGTGTTATCAGACACTGCTGCTGCTGACCTGAGGACAGTCTCTCCACCGCTGCACAGCCAGTGAAACTTTAGGCATCTTTGGATTTCTGATATAATCTAAAAATGTTCCATATTTTCTCTTTAAGGGGAAGGTAGTCATGGGATATAGCTTTTCTCAGCCTACAAGGTAGGACTGAAAGATACCATTTCAGTCACCTGTACCTTGAACCTTACACTCCAACAGAACCCCCTGTCCCTTCACCTGGGCAGACTGACAAGCTCATGCAGACATCCACGCATGGACCCTTCTCCCCACCTACCGTAAGAGCACAGGCTCTCAAGTCAGACTGCCTGAGCTCAGTCACTTACCAACTAGGTGACCTTAGCCAAATTACTTTCTCATGTTTTATGCCAGGAAATTGAATAAAACAAGAATTTACTCTGAAGAAATAAGAGCAAGGATAGAATTTAGATAGAAAAAGAAAACTAATTTGTAGTGAGGTGTGTTCCTTCTTCTCCAGCATGAGTCAAAATAATCCAGTAAGTTTCATATGGGTAACTCATTTTAAATAAACTTCAACGGGCCACAAGCATGATTTGTGGACTGTGCATGAGCTATTTGTGGCTTTTTTAAGGTACAAAGTGAGAGGAACATGAAGTTTTTCACTCAAAAATGACCCCCTAGCCACTGAATACATTCAATTTGCTTTAGGAAGCACTGAAGTAAGCTATCCTTTCTCTAAGTTGTAGAACGTAGAATGGATATCTTAAACAGATACATGCAAAGTTTAAAATCACGGCCATACCAGAAGAAATGTTCATTAACAACTTATTTAGGATTTATAGAAACGTACCTCTTTTGTTTGATTTGCCTTAGCAACTGCATCCTGTGTCAGGCGCTCCTGAACCAAAATCCGAATTGCCTAAGAAACCCAAAAATATTTTTACTTTTTATAGGCTGTGTACCTGTCATCCTTTCTTCTATGAGCCCAGAGAATAAGGATGCTCATTTTGATGAAGTCAGAATTACCTAAGTTCATTAATAAACTCCCCATTAAATTAAAAATAAAAAAAACCCACTAATATAACGTAACCTTTCACACTTCTAGTATTTTAATAATGTTGAATGGTGCTTGCAACAATTAAAACCATTTTTTGAATAGGTAATGCACGTGACTGGTAAAAAACAACTTTAAATACAGCAAGACACATGGTAAAAAGTAGGTCTCCTTCCTACCTGAGCCTTGCGATCCCCTACAGATTCCTTACCCTCACTAAAACTGCGAAATGACGAGCATGCTTAGCACGAATACACATTTTTGACACAAAGGGTAGCAGATCATACATACTGTCTTACACTTTGCTTTTATCACTTCACTCTAGTAAAATATTTTCAAACCTTTCAAAGGACACCGTTGGTGGTTTTAATCACCAAGGCATTTCATTATGGTAGGCATGCATGCAAGTATCCATACACACTTAAAAATCAAATTTTAAAAAAATGGAATTTTAATTAGGAAGATGACAATTACAACTCAAAAATAAGTGTGAAAACTTAAACTATAATTTTTAAATAAAAAACCAAATGCTATCTTTGAAAAACCGAATTCAAACAATGTTTAACAGTTATTGCAGATGTTATTAAATAGTCTGGTTGCCAAACAGTTAATATACTGATGCTTGTACTTGGCAAACGTACTAAGATGTTTTCCATATTATGTTATTGTTTGAATGCCTCTTAAAATAACTCAAAAGGGACAAATGTGCAGCAGGACTAGAATTTTATAGCATTTTGTTGTAGTTGATTTATACTTTATCCCCTTGGGTTTTGAAGTCTAACAAAAGCATCCCAAATACGCTATGCATTGTCTGACTCTCCTCTCACTTACTTTATGATTAAAGCTGACATGATCACTATAGAACAGTTCCAAGGCAATTTACATAATTGTCGGAATAAAGAACAAGCCTTTGAAATAGCTAAATTTCACTAAAAACATTTTTGTCTTTTGGCATGCAATCTGGATTGAGAAAATCCAAGTTAACATTCAGATTCAGTATAGAAAATTTTAATAACTTAGGAATACAACAGTCTTGTTAAAACTGACATTTAATAATAAAAATCTAAAAAGCATGGTAAGTTATGGCTTAATCTCTTCTGGGTAGAGTGATATTTATCACAAAGTAGTTTACATGCACAAGGTCTAGTTAAAAGCTTTTAATCTCTTATAAAATTTCCAAGTCTGGTATCTTAAGTACCACTCCCCTGATCCACACCACTGTACTTTCACGATTACTAGGAATAAATCTTCTGAAGTTTATGATTTCTCTCAGAAACAAGAGACCTCTTTCAGATTACTGGGATTCCTGAAGTATAGTTATGAACTGAGTGGCCTATCTAGCATCGGGGACAGAAAGATTCATTTCTCAAAGAGATTTTGGGGTTATATATTTTTGACCAAATTCACCATTACTCATTTGGCATTTTCGACCATCTTAACAAATGCAGACTATGAATCATTAAAAAGACTAACTAAACAGAAGTAGGGTAATGTGGGAAAAACAATGGACCACAGGGTTATAGTGCTTAAAATCCTGGCTCTGTCATTTTCTGTGTCATCTTAGACATTATCCTCATTGAGTCTCAGTTTCTTCATATGATATATATTTTTAAAAAGATATTAGCAGCTGTCTCTAGGATTGTTGGCAGGATTGAATGAGAACATCTTTGCAAAGGATTTAGCATAGTGCAGGCAGAAAACAGAATCCAAATCAGATAAAACCATGAAATCTACTTTATGTTTCATATTCTTCTGTGTATTTTAGTCATTCAACCATAATTTTAATATCAATAGTTAATATTTAGAAAATAAAGACATTTTTCTATGTGCACAGTTTCTGTCAAGAATCAAGAACATGAAGCTGACCTTAAGCATTACCAGGTAATCATCATGACGCTGAATCTGAAGCAGGTTAGCCAAAGCCATCACACCAGCCTTAAAATCAGGA