Transcript asmbl_25612

Sequence
Transcript Sequence for observation asmbl_25612 of TGE0000867:
CACGTGGGGACGCAGGATGGCGGCAGCAGTGCCGGACGAGGCGGTGGCGCGCGATGTGCAGCGGTTGCTAGTGCAGTTCCAGGATGAGGGCGGGCAGCTGCTGGGTTCCCCGTTCGACGTGCCCGTGGACATCACCCCGGACAGGCTGCAGCTCGTGTGCAACGCGCTACTGGCCCAGGAGGATCCCCTGCCACTGGCTTTCTTTGTCCACGATGCTGAGATCGTCTCCTCACTGGGGAAGACGTTGGAGTCCCAGGCAGTGGAGACAGAGAAGGTCCTAGACATCATCTACCAGCCACAGGCTATCTTCAGAGTCCGGGCTGTGACTCGCTGCACCAGCTCCTTGGAGGGTCACAGTGAGGCAGTCATTTCTGTGGCCTTCAGCCCTACGGGAAAGTACCTGGCCAGTGGCTCTGGAGACACCACCGTGCGCTTCTGGGATCTCAGCACAGAGACACCACATTTCACATGCAAGGGACACAGACACTGGGTCCTTAGTATATCCTGGTCTCCAGATGGCAGGAAGCTGGCCTCAGGCTGCAAGAATGGCCAGATTCTCCTCTGGGACCCAAGCACAGGGAAGCAGGTGGGCAGGACCCTCGCTGGCCACAGCAAGTGGATCACAGGCCTGAGCTGGGAGCCCCTCCATGCGAACCCTGAGTGCCGCTATGTGGCCAGCAGCTCCAAGGATGGCAGTGTGCGGATCTGGGACACAACTGCAGGCCGCTGTGAGCGCATCCTCACCGGGCACACCCAGTCGGTCACCTGTCTCCGGTGGGGAGGGGACGGGCTTCTCTACTCTGCCTCCCAGGACCGCACCATCAAAGTCTGGAGAGCTCATGACGGTGTGCTGTGCCGGACTCTGCAAGGCCACGGCCACTGGGTGAACACCATGGCCCTCAGCACTGACTATGCCCTGCGCACTGGGGCCTTTGAACCTGCTGAGGCCTCAGTTAATCCCCAAGACCTCCAAGGATCCTTGCAGGAGTTGAAGGAGAGGGCTCTGAGCCGATACAACCTCGTGCGGGGCCAGGGTCCAGAGAGGCTGGTGTCTGGCTCCGACGACTTCACCTTATTCCTGTGGTCCCCAGCAGAGGACAAAAAGCCTCTCACTCGGATGACAGGACACCAAGCTCTCATCAACCAGGTGCTCTTCTCTCCTGACTCCCGCATCGTGGCTAGTGCCTCCTTTGACAAGTCCATCAAGCTGTGGGATGGCAGGACGGGCAAAGATGACTTTCACTCTGTCACCTGGTGTTCAAGTGGCTCGAGTGCAGCGGCACGATCT