Transcript asmbl_30207

Sequence
Transcript Sequence for observation asmbl_30207 of TGE0056176:
TCTTAGGCCCCGTCTCACCCTTTCGGATGCCTCCCCTAGAACCCTACCACTTTCCACCCCTTTCCGTCTGTTATTTCTCCCAAACTTGCGCCCGCACAGGCCCCTCTGGAACACTCCTGCCCCGTAGTGCCCCTCGTCCCCGCTCCGTAGAGAAAGAGCGTGCGTGCCGCGCATTTCTGGCCTGGGGAGCGGGTGGAGTAAACCTGCGGGAACCATTTTACGACAACGTGCGGCTGTGCGGTGTGGCTGACGGCAACGCCGCTGCTCTTGGAGAGGTCACTCCGGAGACGGCGTTGGTTTTGGGGTGTGGGGGGTTGGTGGCACTATGTGGCGCGTCTGTGCGCGACGGGCTCAGAATGTAGCCCCATGGGCGGGACTCGAGGCTCGGTGGACGGCCTTGCAGGAGGTACCCGGAACTCCACGAGTGACCTCGCGATCTGGCCCGGCTCCCGCTCGTCGCAACAGCGTGACTACAGGGTATGGCGGGGTCCGGGCACTGTGCGGCTGGACCCCCAGTTCTGGGGCCACGCCGCGGAACCGCTTACTGCTGCAGCTTTTGGGGTCGCCCGGCCGCCGCTATTACAGTCTTCCCCCGCATCAGAAGGTTCCATTGCCTTCTCTTTCCCCCACAATGCAGGCAGGCACCATAGCCCGTTGGGAAAAAAAAGAGGGGGACAAAATCAATGAAGGTGACCTAATTGCAGAGGTTGAAACTGATAAAGCCACTGTTGGATTTGAGAGCCTGGAGGAGTGTTATATGGCAAAGATACTTGTTGCTGAAGGTACCAGGGATGTTCCCATCGGAGCGATCATCTGTATCACAGTTGGCAAGCCTGAGGATATTGAGGCCTTTAAAAATTATACACTGGATTCCTCAGCAGCACCTACCCCACAAGCGGCCCCAGCACCAACCCCTGCTGCCACTGCTTCGCCACCTACACCTTCTGCTCAGGCTCCTGGTAGCTCATATCCCCCTCACATGCAGGTACTTCTTCCTGCCCTCTCTCCCACCATGACCATGGGCACAGTTCAGAGATGGGAAAAAAAAGTGGGTGAGAAGCTAAGTGAAGGAGACTTACTGGCAGAGATAGAAACTGACAAAGCCACTATAGGTTTTGAAGTACAGGAAGAAGGTTATCTGGCAAAAATCCTGGTCCCTGAAGGCACAAGAGATGTCCCTCTAGGAACCCCACTCTGTATCATTGTAGAAAAAGAGGCAGATATATCAGCATTTGCTGACTATAGGCCAACCGAAGTAACAGATTTAAAACCACAAGTGCCACCACCTACCCCACCCCCGGTGGCCGCTGTTCCTCCAACTCCCCAGCCTTTAGCTCCTACACCTTCAGCACCCTGCCCAGCTACTCCTGCTGGACCAAAGGGAAGGGTGTTTGTTAGCCCTCTTGCAAAGAAGTTGGCAGTAGAGAAAGGGATTGATCTTACACAAGTAAAAGGGACAGGACCAGATGGTAGAATCACCAAGAAGGATATCGACTCTTTTGTGCCTAGTAAAGTTGCTCCTGCTCCGGCAGCTGTTGTGCCTCCCACAGGTCCTGGAATGGCACCAGTTCCTACAGGTGTCTTCACAGATATCCCAATCAGCAACATTCGTCGGGTTATTGCACAGCGATTAATGCAATCAAAGCAAACCATACCTCATTATTACCTTTCTATCGATGTAAATATGGGAGAAGTTTTGTTGGTACGGAAAGAACTTAATAAGATATTAGAAGGGAGAAGCAAAATTTCTGTCAATGACTTCATCATAAAAGCTTCAGCTTTGGCATGTTTAAAAGTTCCCGAAGCAAATTCTTCTTGGATGGACACAGTTATAAGACAAAATCATGTTGTTGATGTCAGTGTTGCGGTCAGTACTCCTGCAGGACTCATCACACCTATTGTGTTTAATGCACATATAAAAGGAGTGGAAACCATTGCTAATGATGTTGTTTCTTTAGCAACCAAAGCAAGAGAGGGTAAACTACAGCCACATGAATTCCAGGGTGGCACTTTTACGATCTCCAATTTAGGAATGTTTGGAATTAAGAATTTCTCTGCTATTATTAACCCACCTCAAGCATGTATTTTGGCAATTGGTGCTTCAGAGGATAAACTGGTCCCTGCAGATAATGAAAAAGGGTTTGATGTGGCTAGCATGATGTCTGTTACACTCAGTTGTGATCACCGGGTGGTGGATGGAGCAGTTGGAGCCCAGTGGCTTGCTGAGTTTAGAAAGTACCTTGAAAAACCTATCACTATGTTGTTGTAACTAACTCAAGAATTTCTAAACTCTCCCAGGTCACACTGATTCATTCTTAACAAGATATTTATATGTTATTAAACAGGTGGTTCTTTTTATTTTAACCAGTTATTTTTATTATTGAGTCTGTCCAGATAAGTTATTTATAATGGGCATTACTGAATTTTTAAAATGCCGATTACACCCAAATATTGTGCACATTTAATAATCAGACACCAGATTTTTAGCTCTGTACTCCTAATTAAGGGACATGTATGTGGCCTTGCCTAGCCCTTTGGTGATAAGTACTTCCTCTAGGAAATGTACGATAGGTAGAATTGTGGTTCCCTAAAGACAAGTACATAAAGGTGACCCTGATGAAACCTTGAAGTTCTGAAATTTAACTGCCTAAAATGTTCTCCTTAGATGTGAGAGAAAGAGAAATCAGAAAAATTAATTCTCTTGGGGGAAGGGCTTGAATTGAAGCTTTACTTTAGAATTTAGCCCTGGTTTGAAATTTTCCATTACATGATCTTGGTTTATCATCGATGGGAAGGGTAGAAAACTTCAAGGAAAATAAGTGAAATTTTAAAAGTCAGCATTTTCTTAGACCTCTTCAGCTGATTGTTTATTTTTCTATGAATTCCTACACATGGTTATTCCCCCCTACTTGAGATAATCTAAATATAAACCAGCTACTTGATGTAACTGAGAATTTGTGTGGATATTTATTTAAACAAATGTGTAATTTTGAGTACAGAATTCAACAGTTACCTCCAAAAAAGAAACATTGTTAATATAATTTAACAGAAGTTGTGAAACTAAAATTTTCTAAGATTAACTGGTAGTTCATTGTAAATGAACATAATGAACAGAATTTATGACTCCACTGTGGAAAATGCTATCAAATAACTAAGGAATATATATGGAATAAGTGTACATATGTAAAATATTGTTACTAGAGTTAGATATGTGCCAAAGTCCATTTATCCCAAATCCTGTCTGAAAAGGAGGGGTACATTGGTAAACATTTTGGAGTGCTTAAAAATGCCAAAAACAAAATGGTAATTTCTACTTTGATAAAGTAAAAAAGTTAAATGTGTGTAAAAAAGTGTTCTGTGTCCTTCTACTCCAGCATCGTCTCATGTAAAATAAGAAAGCCCTAAAATACTATTGGAGAGAAAAAATTAACTAGGTTGCTACTTTATTTGCCTAAATACTTTTTTCTATTTTGTTAGATTTTGCCTTTCTTTTGGAAGGAAGGAGGCGATATTCTGGATTATAAAAATGAATTGGGAACATTATCACAATTCCAGACTTTCTATTAATATTTATGTGTTTTAATAAACGTTTGAAATTATTTATGACTACTTAAAATGAATCTGACCAGTGCTTCCTGGTATATGTAATATGTGGAGTTAGCCCCTGAAATTTGCTTTAAGTGTTTCAGTGTTGAATCTGTTTCTAAATATTCATTATTACATGGTACACAAGTGACACTCCATATATTCCACACAGACTTTTACCTTGCTGTATTATTATGAAAACAATACATTAATTTGATTTTTCAGTAATTAGTAATTTTAGGTTGAAGATTATCCAAAAGAAACAAGCTTATCACAAGGGACCATCATCAATATGATCCAAATCTGGTTCAAACATTCAAAACTTCAAAGATAATTCATCTTTCGCTAATGCTTGTGGTTCTGTTGTTCCCTTGAAAAAAAATAAAAACAGTTGCCTTCTAATAAACATTGTTGAGTTAAAAATTAATCTGAGCTATAATCTAAATCGATTCAGTCTCTTACCAGAACTGAAAGAAAAAAGTTAGAAATAGTGTTTTTGGTTCATATGATTATTTAAAAATTAAAGTATAAATCTTCAATAT