Transcript asmbl_23481

Sequence
Transcript Sequence for observation asmbl_23481 of TGE0056759:
GCGCCCCCCGTGCAGCCACCTGCTGCACTTGCGCACTGGGAGCGACACGCTCGGGCATAAGTAGTGCCGGAAAGTTAGCTGCCGAGACCTGGTGGATTGCTTTTCGTTTATCAGTGCAGGAAAACAGCGCTATAGTATGCGTCACAACTAGCGCAGACTCCGGCAGTATTTAGGCGGTGCGGCTTGGGAACTAGAATCCACTTCCTGTCTTCCGCCTCAGGCTAGAGGGCGAGCGCTTCGCCGTGGGACTTCTTCTGCCTGGCTCCGCCTTTTGCCCCGGAAGTACTCACAGCGGACGGTGGTTTTTGGGCCCGTTTCTGAGCAGCGCTTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCAATGGTAAGCTTCAGGGGTGTGAAGTCGCCGGCGTTCTTGGGTTTGAGGACTCAGTGGGGAGAGCCTTCGGCGGGAGCGCTCCTTGGCCTGCCGGCCTCGGTTGCAGGGCGGGCGCGGTTATTGCTTGGCCCATGTGCTCTGGTGGTGGAGTTTGCGGGGGCTGAGGGCGCAGTATTAGGGGACTTTGGCGCTATTTGAGGACCTGGTTGCATTCCCGCTGCCCTCCTACAGCCGCCTAAGGACGACAAGAAGAAGAAGGACGCTGGAAAGTCGGCCAAGAAAGACAAAGACCCAGTGAACAAATCCGGGGGCAAGGCCAAAAAGAAGGTAGAAATAAGACCTCTCTGAAAGAGACTAGGGGTAACTCTCTCGTAATCCTCTAGTAATAGGTAACTTGTATAGTAAGTGGTTTTTCAGGTGTAGATTTCTAGAGTCAAAATGTGAGAGTTTATCTTCCCGTCACCACTCGTTCTTTTTCCCATTAGGATCATGAAAATGGGTCTGTTGTGCGAAGTGTCTGCCGCTGTGCCTGCTGTGTTATTTTTAACTGATCTAGTGGGGCTCGGCCCCTGTTTGAAGGCCAAAAACGTGTCGGTGTTTTTTTTTTGTTTTTGTTTTAGTAATGTGTAATTTATCCTTGATAACGGTGGAACAGATTTCTCTGACGCAGATTACTCGAGAGGGAAAGGGTGCTTCTGCCAGAAATACTAACTTGTTTCTGTTTTGTTTTGGTGAGCAGAAGTGGTCCAAAGGCAAAGTTCGGGACAAGCTCAATAACTTAGTCTTGTTTGACAAAGCTACCTATGATAAACTCTGTAAGGAAGTTCCCAACTATAAACTTATAACCCCAGCTGTGGTCTCTGAGAGACTGAAGATTCGAGGCTCCCTGGCCAGGGCAGCCCTTCAGGAGCTCCTTAGTAAAGGACTTATCAAACTGGTTTCAAAGCACAGAGCTCAAGTAATTTACACCAGAAATACCAAGGGTGGAGATGCTCCAGCTGCTGGTGAAGATGCATGAATAGGTCCAACCAGCTGTACATTTGGAAAAATAAAACTTTATTAAATCAA