Transcript asmbl_23479

Sequence
Transcript Sequence for observation asmbl_23479 of TGE0056759:
GCGCCCCCCGTGCAGCCACCTGCTGCACTTGCGCACTGGGAGCGACACGCTCGGGCATAAGTAGTGCCGGAAAGTTAGCTGCCGAGACCTGGTGGATTGCTTTTCGTTTATCAGTGCAGGAAAACAGCGCTATAGTATGCGTCACAACTAGCGCAGACTCCGGCAGTATTTAGGCGGTGCGGCTTGGGAACTAGAATCCACTTCCTGTCTTCCGCCTCAGGCTAGAGGGCGAGCGCTTCGCCGTGGGACTTCTTCTGCCTGGCTCCGCCTTTTGCCCCGGAAGTACTCACAGCGGACGGTGGTTTTTGGGCCCGTTTCTGAGCAGCGCTTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCAATGCCGCCTAAGGACGACAAGAAGAAGAAGGACGCTGGAAAGTCGGCCAAGAAAGACAAAGACCCAGTGAACAAATCCGGGGGCAAGGCCAAAAAGAAGGTAGAAATAAGACCTCTCTGAAAGAGACTAGGGGTAACTCTCTCGTAATCCTCTAGTAATAGGTAACTTGTATAGTAAGTGGTTTTTCAGGTGTAGATTTCTAGAGTCAAAATGTGAGAGTTTATCTTCCCGTCACCACTCGTTCTTTTTCCCATTAGGATCATGAAAATGGGTCTGTTGTGCGAAGTGTCTGCCGCTGTGCCTGCTGTGTTATTTTTAACTGATCTAGTGGGGCTCGGCCCCTGTTTGAAGGCCAAAAACGTGTCGGTGTTTTTTTTTTGTTTTTGTTTTAGTAATGTGTAATTTATCCTTGATAACGGTGGAACAGATTTCTCTGACGCAGATTACTCGAGAGGGAAAGGGTGCTTCTGCCAGAAATACTAACTTGTTTCTGTTTTGTTTTGGTGAGCAGAAGTGGTCCAAAGGCAAAGTTCGGGACAAGCTCAATAACTTAGTCTTGTTTGACAAAGCTACCTATGATAAACTCTGTAAGGAAGTTCCCAACTATAAACTTATAACCCCAGCTGTGGTCTCTGAGAGACTGAAGATTCGAGGCTCCCTGGCCAGGGCAGCCCTTCAGGAGCTCCTTAGTAAAGGACTTATCAAACTGGTTTCAAAGCACAGAGCTCAAGTAATTTACACCAGAAATACCAAGGGTGGAGATGCTCCAGCTGCTGGTGAAGATGCATGAATAGGTCCAACCAGCTGTACATTTGGAAAAATAAAACTTTATTAAATCAA