Transcript asmbl_25611

Sequence
Transcript Sequence for observation asmbl_25611 of TGE0000866:
CACGTGGGGACGCAGGATGGCGGCAGCAGTGCCGGACGAGGCGGTGGCGCGCGATGTGCAGCGGTTGCTAGTGCAGTTCCAGGATGAGGGCGGGCAGCTGCTGGGTTCCCCGTTCGACGTGCCCGTGGACATCACCCCGGACAGGCTGCAGCTCGTGTGCAACGCGCTACTGGCCCAGGAGGATCCCCTGCCACTGGCTTTCTTTGTCCACGATGCTGAGATCGTCTCCTCACTGGGGAAGACGTTGGAGTCCCAGGCAGTGGAGACAGAGAAGGTCCTAGACATCATCTACCAGCCACAGGCTATCTTCAGAGTCCGGGCTGTGACTCGCTGCACCAGCTCCTTGGAGGGTCACAGTGAGGCAGTCATTTCTGTGGCCTTCAGCCCTACGGGAAAGTACCTGGCCAGTGGCTCTGGAGACACCACCGTGCGCTTCTGGGATCTCAGCACAGAGACACCACATTTCACATGCAAGGGACACAGACACTGGGTCCTTAGTATATCCTGGTCTCCAGATGGCAGGAAGCTGGCCTCAGGCTGCAAGAATGGCCAGATTCTCCTCTGGGACCCAAGCACAGGGAAGCAGGTGGGCAGGACCCTCGCTGGCCACAGCAAGTGGATCACAGGCCTGAGCTGGGAGCCCCTCCATGCGAACCCTGAGTGCCGCTATGTGGCCAGCAGCTCCAAGGATGGCAGTGTGCGGATCTGGGACACAACTGCAGGCCGCTGTGAGCGCATCCTCACCGGGCACACCCAGTCGGTCACCTGTCTCCGGTGGGGAGGGGACGGGCTTCTCTACTCTGCCTCCCAGGACCGCACCATCAAAGTCTGGAGAGCTCATGACGGTGTGCTGTGCCGGACTCTGCAAGGCCACGGCCACTGGGTGAACACCATGGCCCTCAGCACTGACTATGCCCTGCGCACTGGGGCCTTTGAACCTGCTGAGGCCTCAGTTAATCCCCAAGACCTCCAAGGATCCTTGCAGGAGTTGAAGGAGAGGGCTCTGAGCCGATACAACCTCGTGCGGGGCCAGGGTCCAGAGAGGCTGGTGTCTGGCTCCGACGACTTCACCTTATTCCTGTGGTCCCCAGCAGAGGACAAAAAGCCTCTCACTCGGATGACAGGACACCAAGCTCTCATCAACCAGGTGCTCTTCTCTCCTGACTCCCGCATCGTGGCTAGTGCCTCCTTTGACAAGTCCATCAAGCTGTGGGATGGCAGGACGGGCAAGTACCTGGCTTCCCTACGCGGCCACGTGGCTGCCGTGTACCAGATTGCGTGGTCAGCTGACAGTCGGCTCCTGGTCAGCGGCAGCAGTGACAGCACACTGAAGGTGTGGGATGTGAAGGCCCAGAAGCTGGCCATGGACCTGCCCGGCCACGCGGATGAGGTATATGCTGTTGACTGGAGTCCAGATGGCCAGAGAGTGGCAAGTGGTGGGAAGGACAAATGCCTCCGGATATGGAGGAGATGAGACGGCCCGAAGTTCTCTCTGACCCCCACCTCGACTCGGCCTCTGCCAGCTGCCTTCCCTGCCAGAGAACAAAGGCTGAGATGGCAGTGCACACACCCTCCCCACCAGTGGGGACCTGAGAATGCGTGTGGCCTGCTGTCCTCGATAGACCGGAATGGGGTTTTCCCACAGATCCCCGCCTGTGGCACACCCCAGAGCCAGAAATCGAAGGTCACAGGAAGTTGTCACTGAACTTGGCCCGTGTCTGCTACTCTGTACCTTGCTGGTACAGACAGGGGTGGTGGGCAGCCAGGCTCTATGAGTGGGCCCCTAGTGTCAGCTCTGTACAGGGTCAGATCCCAGGTTCTATGACCAAATAAGTAACTTAAGTTTTGTGTGTTGGGTTCTAATTCCTTGTCCTAGAATCCCCATGACTCAATCAAGGACTGTGCTAAATGAGATTGTCCAGCCCCCGCCCTTGCACTGGACTACGCCAAAACCACACTGACCAGGCACTTGCCTTCCCTCTCTTCCCCCGTGTTGGTAAGAGAGAGGCCAGTTGTGATAGTGGCCAAGGAGAATCTAGGGCTGTATTGTTGTCCACTGCAGTAGGCACCGGCCACATGTGACTGCTGGCATGAAATAGAAGTGCAGTTCCTCCATCGCACTGGGTAAGGCCTCCAGTATTGGACAGCACACAGAAAGGTTTTCATCATCAAGAGAGTTCTGCTGGTCAGCCCTGCTCCAGGGGATGCCTCTGCCTTCGCATAGCACACTGCTTGAGGCCCTGCCAGGCACCAAGCACTGCCCTGGGCCCATGGGATAGAGCGGGGAAGGTGATGGCTCTTCCAGAGGATTCCCTCAGATGGGGAGGCAGCAGTATGAGCTCTGAGCAGAAGTGGGTATTGTTGATACAGAGGAAGTTCTTTGCCACGAGAACTTTCAAGCAGTGAAAGGAATTCCCATCAGGACTCAGACCCCAGGCCGAGATCTTGCCCTGAATGTACCCTGCCTCTGCTTTCTCCTGCATCCCATGCTAAGCAGGGTCATGGTCTGAACTACTCAGATTGGATTTCCAAACCATCCTTGT