Transcript asmbl_133040

Sequence
Transcript Sequence for observation asmbl_133040 of TGE0056699:
GCCCCAGAGAGCAGGCGCTGGGCAGTGTGGAGGTCGTTGGAGTCACTTCCCCGTCACCAGCTCCTGTGCCTGCCAGTCGGTGCCCCTCCCGCTCCAGCCATGCTCTCCGCCCTCGCCCGGCCTGCCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCGGCCCAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCACTTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCCGGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGACCTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGGTAGTTATTCCGGCTGGAGTCCCCAGAAAGCCAGGCATGACCCGGGACGACCTGTTCAACACCAATGCCACGATTGTGGCCACCCTGACCGCTGCCTGTGCCCAGCACTGCCCGGAAGCCATGATCTGCGTCATTGCCAATCCGGTTAATTCCACCATCCCCATCACAGCAGAAGTTTTCAAGAAGCATGGAGTGTACAACCCCAACAAAATCTTCGGCGTGACGACCCTGGACATCGTCAGAGCCAACACCTTTGTTGCAGAGCTGAAGGGTTTGGATCCAGCTCGAGTCAACGTCCCTGTCATTGGTGGCCATGCTGGGAAGACCATCATCCCCCTGATCTCTCAGTGCACCCCCAAGGTGGACTTTCCCCAGGACCAGCTGACAGCACTCACTGGGCGGATCCAGGAGGCCGGCACGGAGGTGGTCAAGGCTAAAGCCGGAGCAGGCTCTGCCACCCTCTCCATGGCGTATGCCGGCGCCCGCTTTGTCTTCTCCCTTGTGGATGCAATGAATGGAAAGGAAGGTGTTGTGGAATGTTCCTTCGTTAAGTCACAGGAAACGGAATGTACCTACTTCTCCACACCGCTGCTGCTTGGGAAAAAGGGCATCGAGAAGAACCTGGGCATCGGCAAAGTCTCCTCTTTTGAGGAGAAGATGATCTCGGATGCCATCCCCGAGCTGAAGGCCTCCATCAAGAAGGGGGAAGATTTCGTGAAGACCCTGAAGTGAGCCGCTGTGACGGGTGGCCAGTTTCCTTAATTTATGAAGGCATCATGTCACTGCAAAGCCGTTGCAGATAAACTTTGTATTTTAATTTGCTTTGGTGATGATTACTGTATTGACATCATCATGCCTTCCAAATTGTGGGTGGCTCTGTGGGCGCATCAATAAAAGCCGTCCTTGATTTTATTTTTCAAGGTCCCTTCTGTAAATGCTGTGCTTTCTTCCCTGTGAGAGCCAACTTTAGAGTGTCTGCTACCTCTTCATTACCAATCAGAATTAGATGATGTTTAACTGTTAGACTGAAGCGTGACGCTTTCATCAGTAGCTTCAAGAAAGTCTAAATTGTTAATTTATGGAATTGGACACAGTATTCAGTTTACCCGTACATGCTCCTCCCGCCCCTCCTGTTGGCACCCTTGCATCGCCCAGGCCTGATTCCTCCTGGGGGTAGTTCACCCCCACGGGTTCATAGTTCAGCGGCGAATGCCAGGCAGCTGTTTTCTGGCTGAGCAAACAGCACCTTTCTCATTGAGCTTCCTCTACTGACCTCTGTCCCCCTTGGGATTTCATCTTCTGACCGAACCCTGATGTTCAGTGGCAGAGACAGCCCATAGCCAGAACTGTGGGTAGACCAGGGTTGGGGTGTGCGGTTTGGGACAGCCCAAACCCCAGCCGCTGTGTCAAGGCCTAGGACGCCATGCTGCCATCAAAAGGGGGTTCCAGGTTTCCATCAGTGGCCTAAAGAAGGGACTTCTTGTTGTACTGAGGAGTGCGGAATTAAAGAGATTTGACTCCCTTTAGTATTGGGGGCAGTCCGTTCCCCAGACACTGTGGCCTCTGAAGTGGAAACTGAAAGCTGCATACCTGGGAAAGAACTTTCTAGGAATAGGCAATGGCCTTCAGTGGAAGAGGGAGGGCTGGAGGTGTGCCCAGTACTTGGATGTTCATCTGTCCACAACAGCTTTTTGTTTTTTTAAAAAAGCTAAAATGGAAATGGATTTTATCATAAAGGATGACATCGTTTTCTTCTACAATTAATACATGTTCATTGTATAAAACCCAAAAAGCAGCTAAAAAATAAAGCGGGAAAGGAACTACTGGTAA