Transcript asmbl_123402

Sequence
Transcript Sequence for observation asmbl_123402 of TGE0056691:
TCTGAATCCTTAAACAATATCTGGCAATACTATTCAATATTATTATCAATAACATTTACTGAGCATTTACTCTATGCCAGACACTATGATAAGTAATGTGTGTGCATTTGTTTCTGTTAATTCTGCCAATCGTCCTATGAAGAAGGAGTTATTATCACCCTATTTAAAGAGTGGGTAACTGAGGCTTGGAGAGGAGCTTGGGAAACATTTAGTAAATACATCAATGACTATTAGCAGTACAATTCATGCTTCCTACCTGCTTCCATGATAATAACTGGAACCTTCAAGAAAGTGATTATAAAATATGTAATAAAGGACTCTGGTACAGTCAGCTTTCAGGCACACATTAGTCATTGTCTCTAGAAAGTAGAATAGTAAAGCAGAGCCTTGGGAGAGCTTGGGGGCAGACAGCATGGCCCCAAGACACTATTTCTGAGTCCCACAAATAGCACATTTTAGTTGCTGAACCAATAGAAAATAGCCTGAATTCCTCCTAGATCATCTAATATTATTGTTCAATTTAAATACTTTTGGCTTCAAGTAGCAGAACTAATGTGGCTGAAACAGATGGGGACTGATTTTCTCATATAAGAAATCCTGAAATAGGTGGTCCTGATGCGGGCTTAGCCATTTAACAGCATCATTAAGGCCCCCAAATCCCCAAACGCCTCTCAGCTTTCTACTCTGCCACCTTCTCATTGTCAGCAGTGTTTCTGTTCACTGTCTCACGATGGCCACAGCAGCTTCAAGCATCCCTTCACCTGAAAACACCTGAAAACAGCTGAAAGCAGAAGGGGAAGGACAAACTCATCCATGTACCTCTCTCCTTTTTCAAAGGGGAAAAATGTTTCCCAGAAGCCACCTAGCAGACTTCCTCTTCCTCCTGGCAGTAGGTCACATAGCCACAGTTAGCCCAAAAGAAGTCCAGGGAAGCAAGCGATGGGCATGGTGGCATGGCATTGTCTTCTCTCCTGTGAGAGGTAGGACTTATCACAAGGACAGAGGAGGGAGAAAAATGGTTGCTTCTTAGACAGTTTATTATCTCAGCCTCAAATAATCTTTATTTAAAGTACTACTAAATCAACTAGATTCGCCTTTAGAATATTTTCAAAACCTGTTTGGCCCTATGATACGAATCCAATGTTGTTGAAGAAAGGGGCATGTCAGCTCCAGAGATCTCTAGACGACTGCTCTATGGACAGTTAAAGACTTTGGCAACAGCAGACATGTGATGATGGCTAATGCTCTCCTCTCCTGTTTCCAGGTCAACAGCGACCTCATTTACATTACAGCTAAGAAAGATGGCACTCATGTGGTGGAAAATGTGGATGCCACCCACATTGGGAAATTAATTGTGACCAAACAAATTGGAGGAGATGGCATGATGGATATTACTGATACTTACAAATTCCAAGAAGGTCAAGAAGAAGAGAGATTGGCCCTAGAAACTGCCCTGATGTACGGAGCTAAAAAGCCCCTCAACACAGAAGGTGTCATGAAATCAAGGTCCAACGTTGACATGGACTTTGAAGTGGAAAATGCTGTGCTGGGAAAAGACTTCAAGCTCTCCATCACCTTCCGGAACAACAGCCACAACCGTTACACCATCACAGCTTATCTCTCAGCCAACATCACCTTCTACACCGGGGTCCCGAAGGCAGAATTCAAGAAGGAGACGTTCGACGTGACGCTGGAGCCCTTGTCCTTCAAGAAAGAGGCGGTGCTGATCCAAGCCGGCGAGTACATGGGTCAGCTGCTGGAACAAGCGTCCCTGCACTTCTTTGTCACAGCTCGCATCAATGAGACCAGGGATGTTCTGGCCAAGCAAAAGTCCACCGTGCTAACCATCCCTGAGATCATCATCAAGGTCCGTGGCACTCAGGTAGTTGGTTCTGACATGACTGTGACAGTTGAGTTTACCAATCCTTTAAAAGAAACCCTGCGAAATGTCTGGGTACACCTGGATGGTCCTGGAGTAACAAGACCAATGAAGAAGATGTTCCGTGAAATCCGGCCCAACTCCACCGTGCAGTGGGAAGAAGTGTGCCGGCCCTGGGTCTCTGGGCATCGGAAGCTGATAGCCAGCATGAGCAGTGACTCCCTGAGACATGTGTATGGCGAGCTGGACGTGCAGATTCAAAGACGACCTTCCATGTGAATGCACAGGAAGCTGAGATGAACCCTGGCATTTGGCCTCTTGTAGTCTTGGCTAAGGAAATTCTAACGCAAAAATAGCTCTTGCTTTGACTTAGGTGTGAAGACCCAGACAGGACTGCAGAGGGCTCCAGAGTGGAGATCCCACATATTTCAAAAACATGCTTTTCCAAACCCAGGCTATTCGGCAAGGAAGTTAGTTTTTAATCTCTCCACCTTCCAAAGAGTGCTAAGCATTAGCTTTAATTAAGCTCTCATAGCTCATAAGAGTAACAGTCATCATTTATCATCACAAATGGCTACATCTCCAAATATCAGTGGGCTCTCTTACCAGGGAGATTTGCTCAATACCTGGCCTCATTTAAAACAAGACTTCAGATTCCCCACTCAGCCTTTTGGGAATAATAGCACATGATTTGGGCTCTAGAATTCCAGTCCCCTTTCTCGGGGTCAGGTTCTACCCTCCATGTGAGAATATTTTTCCCAGGACTAGAGCACAACATAATTTTTATTTTTGGCAAAGCCAGAAAAAGATCTTTCATTTTGCACCTGCAGCCAAGCAAATGCCTGCCAAATTTTAGATTTACCTTGTTAGAAGAGGTGGCCCCATATTAACAAATTGCATTTGTGGGAAACTTAACCACCTACAAGGAGATAAGAAAGCAGGTGCAACACTCAAGTCTATTGAATAATGTAGTTTTGTGATGCATTTTATAGAATGTGTCACACTGTGGCCTGATCAGCAGGAGCCAATATCCCTTACTTTAACCCTTTCTGGGATGCAATACTAGGAAGTAAAGTGAAGAATTTATCTCTTTAGTTAGTGATTATATTTCACCCATCTCTCAGGAATCATCTCCTTTGCAGAATGATGCAGGTTCAGGTCCCCTTTCAGAGATATAATAAGCCCAACAAGTTGAAGAAGCTGGCGGATCTAGTGACCAGATATATAGAAGGACTGCAGCCACTGATTCTCTCTTGTCCTTCACATCACCCATGTTGAGACCTCAGCTTGGCACTCAGGTGCTGAAGGGTAATATGGACTCAGCCTTGCAAATAGCCAGTGCTAGTTCTGACCCAACCACAGAGGATGCTGACATCATTTGTATTATGTTCCAAGGCTACTACAGAGAAGGCTGCCTGCTATGTATTTGCAAGGCTGATTTATGGTCAGAATTTCCCTCTGATATGTCTAGGGTGTGATTTAGGTCAGTAGACTGTGATTCTTAGCAAAAAATGAACAGTGATAAGTATACTGGGGGCAAAATCAGAATGGAATGCTCTGGTCTATATAACCACATTTCTAAGCCTTTGAGACTGTTCCTGAGCCTTCAGCACTAACCTATGAGGGTGAGCTGGTCCCCTCTATATATACATCATACTTAACTTTACTAAGTAATCTCACAGCATTTGCCAAGTCTCCCAATATCCAATTTTAAAATGAAATGCATTTTGCTAGACAGTTAAACTGGCTTAACTTAGTATATTATTATTAATTACAATGTAATAGAAGCTTAAAATAAAGTTAAACTGATTATATTTGCATCTGTGCAGAAGTGAATGCTTTTAATTTTCAATATAAC