Transcript asmbl_116185

Sequence
Transcript Sequence for observation asmbl_116185 of TGE0056685:
CAGTCTCAGATCCGGGGGCTGGAAACTGAGGAGGTTCTCCCGGCAAGCCCCTCGGGCTAGTGACATTCTAAGATTCCAAGAGCTAAGGAGCTAGAGGGGTGGGGTGGAGGAGGGAGGCGGGCGCGCCGGATTGGCCTCTGCGCGCCACGTGTCCGGCTCGGAGCCCACGGCTGTCCTCCCGGTCCGCCCCGCGCTGCGGTTGCTGCTGGGCTAACGGGCTCCGATCCAGCGAGCGCTGCGTCCTCGAGTCCCTGCGCCCGTGCGTCCGTCTGCGACCCGAGGCCTCCGCTGCGCGTGGATTCTGCTGCGAACCGGAGACCATGGCCAAACCAGCACAGGGTGCCAAGTACCGGGGCTCCATCCATGACTTCCCAGGCTTTGACCCCAACCAGGATGCCGAGGCTCTGTACACTGCCATGAAGGGCTTTGGCAGTGACAAGGAGGCCATACTGGACATAATCACCTCACGGAGCAACAGGCAGAGGCAGGAGGTCTGCCAGAGCTACAAGTCCCTCTACGGCAAGGACCTCATTGCTGATTTAAAGTATGAATTGACGGGCAAGTTTGAACGGTTGATTGTGGGCCTGATGAGGCCACCTGCCTATTGTGATGCCAAAGAAATTAAAGATGCCATCTCGGGCATTGGCACTGATGAGAAGTGCCTCATTGAGATCTTGGCTTCCCGGACCAATGAGCAGATGCACCAGCTGGTGGCAGCATACAAAGATGCCTACGAGCGGGACCTGGAGGCTGACATCATCGGCGACACCTCTGGCCACTTCCAGAAGATGCTTGTGGTCCTGCTCCAGGGAACCAGGGAGGAGGATGACGTAGTGAGCGAGGACCTGGTACAACAGGATGTCCAGGACCTATACGAGGCAGGGGAACTGAAATGGGGAACAGATGAAGCCCAGTTCATTTACATCTTGGGAAATCGCAGCAAGCAGCATCTTCGGTTGGTGTTCGATGAGTATCTGAAGACCACAGGGAAGCCGATTGAAGCCAGCATCCGAGGGGAGCTGTCTGGGGACTTTGAGAAGCTAATGCTGGCCGTAGTGAAGTGTATCCGGAGCACCCCGGAATATTTTGCTGAAAGGCTCTTCAAGGCTATGAAGGGCCTGGGGACTCGGGACAACACCCTGATCCGCATCATGGTCTCCCGTAGTGAGTTGGACATGCTCGACATTCGGGAGATCTTCCGGACCAAGTATGAGAAGTCCCTCTACAGCATGATCAAGAATGACACCTCTGGCGAGTACAAGAAGACTCTGCTGAAGCTGTCTGGGGGAGATGATGATGCTGCTGGCCAGTTCTTCCCGGAGGCAGCGCAGGTGGCCTATCAGATGTGGGAACTTAGTGCAGTGGCCCGAGTAGAGCTGAAGGGAACTGTGCGCCCAGCCAATGACTTCAACCCTGACGCAGATGCCAAAGCGCTGCGGAAAGCCATGAAGGGACTCGGGACTGACGAAGACACAATCATCGATATCATCACGCACCGCAGCAATGTCCAGCGGCAGCAGATCCGGCAGACCTTCAAGTCTCACTTTGGCCGGGACTTAATGACTGACCTGAAGTCTGAGATCTCTGGAGACCTGGCAAGGCTGATTCTGGGGCTCATGATGCCACCGGCCCATTACGATGCCAAGCAGTTGAAGAAGGCCATGGAGGGAGCCGGCACAGATGAAAAGGCTCTTATTGAAATCCTGGCCACTCGGACCAATGCTGAAATCCGGGCCATCAATGAGGCCTATAAGGAGGACTATCACAAGTCCCTGGAGGATGCTCTGAGCTCAGACACATCTGGCCACTTCAGGAGGATCCTCATTTCTCTGGCCACGGGGCATCGTGAGGAGGGAGGAGAAAACCTGGACCAGGCACGGGAAGATGCCCAGGTGGCTGCTGAGATCTTGGAAATAGCAGACACACCTAGTGGAGACAAAACTTCCTTGGAGACACGTTTCATGACGATCCTGTGTACCCGGAGCTATCCGCACCTCCGGAGAGTCTTCCAGGAGTTCATCAAGATGACCAACTATGACGTGGAGCACACCATCAAGAAGGAGATGTCTGGGGATGTCAGGGATGCATTTGTGGCCATTGTTCAAAGTGTCAAGAACAAGCCTCTCTTCTTTGCCGACAAACTTTACAAATCCATGAAGGGTGCTGGCACAGATGAGAAGACTCTGACCAGGATCATGGTATCCCGCAGTGAGATTGACCTGCTCAACATCCGGAGGGAATTCATTGAGAAATATGACAAGTCTCTCCACCAAGCCATTGAGGGTGACACCTCCGGAGACTTCCTGAAGGCCTTGCTGGCTCTCTGTGGTGGTGAGGACTAGGGCCACAGCTTTGGCGGGCACTTCTGCCAAGAAATGGTTATCAGCACCAGCCGCCATGGCCAAGCCTGATTGTTCCAGCTCCAGAGACTAAGGAAGGGGCAGGGGTGGGGGGAGGGGTTGGGTTGGGCTCTTATCTTCAGTGGAGCTTAGGAAACGCTCCCACTCCCACGGGCCATCGAGGGCCCAGCACGGCTGAGCGGCTGAAAAACCGTAGCCATAGATCCTGTCCACCTCCACTCCCCTCTGACCCTCAGGCTTTCCCAGCTTCCTCCCCTTGCTACAGCCTCTGCCCTGGTTTGGGCTATGTCAGATCCAAAAACATCCTGAACCTCTGTCTGTAAAATGAGTAGTGTCTGTACTTTGAATGAGGGGGTTGGTGGCAGGGGCCAGTTGAATGTGCTGGGCGGGGTGGTGGGAAGGATAGTAAATGTGCTGGGGCAAACTGACAAATCTTCCCATCCATTTCACCACCCATCTCCATCCAGGCCGCGCTAGAGTACTGGACCAGGAATTTGGATGCCTGGGTTCAAATCTGCATCTGCCATGCACTTGTTTCTGACCTTAGGCCAGCCCCTTTCCCTCCCTGAGTCTCTATTTTCTTATCTACAATGAGACAGTTGGACAAAAAAATCTTGGCTTCCCTTCTAACATTAACTTCCTAAAGTATGCCTCCGATTCATTCCCTTGACACTTTTTATTTCTAAGGAAGAAATAAAAAGAGATACACAAACACATAAACACATTTCCAGTGAGGGCCTCTGTCTTCTACCTAGAGCCTGCAGCCTGGATTTTCCTCATTAGAGCTTGAGGTTGTAAAGTCTGTCCAGGAGCGAGTTACGTCTTTAAATTCTTGCAAGGTGTTTCCCGGGAAGCGCACAGGAGAATCTGAGTTTGCAGCAAGCCTGGGAAGGCTGGCCCAGCCCTGCTCCGGGCCTCAGGTTCCCCCTCATCCCCTCTCGCTGTCTGGACATTTCTGTATGCTCTTCATCCATTTCAACCAAGCCCAAACTTCCTCTTTTGAACTATGCAAGGGTGCCCGATGTGATCTTGATCTGGAGAGGTGCATGGAAAGTTTCCTTCATGCAGGTCACTGATAAGCAAGTAGGCGCAACTGCAGTTCCTCTGCCTTCCCTCCCCCGCTGCCCTACTTCTGGTCTGTGGCTTTGGTCTAAGATTGTCCAGTGACCATGGCATGGGGCTGGCTGCTGGCCAAAGGGCACTTCTCCCTACCCTGGCTGACCAGACTAGTTTATTGCAGGTTAGCGCGTGTTTGTTTTCTTTTCTTTCTTTTCTTTTTCTTCTTTTTTTTTT