Transcript asmbl_25603

Sequence
Transcript Sequence for observation asmbl_25603 of TGE0000865:
TCGGTGGTAGGGCTGGGTCTCCGAACCTGAAACCGGGAGCTTCCTGCTCGTGTTCGCTGTTGAGAAGCTACCCGCGGGGTTGTAGACCTCGGACCTCATGGCAGAGATAATTCAGGAACGCATAGAAGATCGGCTCCCGGAATTGGAACAGCTGGAGCGCATTGGACTGTTCAGTCATGCGGAGATTAAGGCTATCATTAAGAAGGCTTCCGATCTAGAGTACAAAATCCAGAGAAGAACCCTTTTCAAGGAAGACTTTATCAATTATGTTCAATATGAAATTAATCTTTTGGAGCTGATCCAGAGAAGAAGAACACGCATTGGATATTCATTTAAGAAGGATGAGATTGAGAATTCTATTGTACACCGGGTACAAGGTGTTTTCCAGCGTGCCTCAGCAAAATGGAAAGACGATGTTCAACTTTGGCTCTCCTATGTGGCTTTTTGTAAGAAGTGGGCTACTAAAACTCGACTTAGCAAGGTATTCTCTGCCATGTTGGCGATTCATTCCAACAAACCAGCTTTGTGGATTATGGCAGCCAAATGGGAAATGGAAGATCGATTGTCTTCAGAAAGCGCAAGGCAACTATTTCTTCGCGCACTGCGCTTTCATCCAGAGTGCCCAAAACTTTATAAAGAATACTTTAGGATGGAGCTGATGCATGCTGAAAAACTGAGGAAGGAGAAGGAAGAATTTGAAAAAGCCAGTATGGATGTGGAGAATCCTGATTATTCTGAAGAAATCCTTAAGGGCGAGTTGGCATGGATCATCTACAAAAATTCTGTAAGCATAATTAAAGGTGCAGAATTTCACGTGTCACTGCTTTCGATTGCACAGCTATTTGACTTTGCCAAAGATCTACAAAAAGAGATTTATGATGACCTTCAGGCTCTACACACAGATGATCCTCTCACTTGGGATTATGTGGCAAGGCGAGAATTAGAGATTGAGTCACAGACAGAAGAGCAGCCTACAACGAAACAAGCCAAAGCAGTGGAGGTCGGCCGGAAGGAGGAGAGGTGCTGTGCTGTGTATGAAGAGGCAGTGAAGACTCTGCCAACAGAGGCCATGTGGAAGTGTTACATCACCTTTTGCTTGGAAAGATTTACTAAGAAGTCAAATAGTGGGTTCCTTAGAGGGAAGAGGTTGGAAAGAACCATGACTGTATTCAGGAAGGCACATGAACTGAAGCTTCTGTCAGAATGCCAATACAAGCAGTTGAGTGTTTCGTTGCTGTGTTATAACTTCCTGAGGGAAGCTCTGGAAGTGGCAGTAGCTGGAACTGAATTGTTTAGAGACTCTGGGACAATGTGGCAGCTGAAGCTGCAGGTGCTGATCGAGTCAAAGAGCCCTGACATAGCCATGCTTTTTGAAGAAGCCTTTGTGCACCTGAAACCCCAGGTTTGTCTGCCATTGTGGATTTCCTGGGCAGAGTGGAGTGAAGGTGCCAAAAGCCAAGAAGACACTGAGGCAGTCTTTAAGAAAGCTCTCTTAGCTGTCATAGGTGCCGACTCAGTAACCCTGAAGAATAAGTACCTGGATTGGGCTTATCGAAGTGGTGGCTACAAAAAGGCCAGAGCTGTGTTTAAAAGTTTACAGGAGAGCCGACCATTTTCAGTTGACTTTTTCAGGAAAATGATTCAGTTTGAAAAGGAGCAAGAATCCTGCAATATGGCGAACATAAGAGAATATTATGAGAGAGCTTTGAGAGAGTTTGGATCCGCAGATTCTGATCTTTGGATGGATTATATGAAAGAAGAATTGAACCACCCCCTTGGTAGACCTGAGAACTGTGGACAGATCTACTGGCGAGCGATGAAAATGTTGCAGGGAGAGTCAGCAGAGGCATTTGTAGCTAAACATGCTATGCATCAGACTGGCCATTTATGAAGATGAAGAATACAGTCAGCTTTGTGAAATAGTATTGCAAGCAAGCCCCGTGGGCAAATTTGTATTGAGTCCATCTGTAATTTGCTCAGTGATGGCAGACAAGATGGCTGTCTGGTTTTGAGACACACTTTAATTT