Transcript asmbl_9165

Sequence
Transcript Sequence for observation asmbl_9165 of TGE0056652:
CATCCCCCTCCTCTCTCTCCTCCTCCGGCACCCCCGTCCGTTCCGACTCTCGCGAGATCCCTACTGGCTATAAAGGCAGCGCCCCGGAGAGCTCTTGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTGATAGGAAGATGTCTTCAGGAAATGCTAAAATTGGGCACCCTGCCCCCAACTTCAAAGCCACAGCTGTTATGCCAGATGGTCAGTTTAAAGATATCAGCCTGTCTGACTACAAAGGAAAATATGTTGTGTTCTTCTTTTACCCTCTTGACTTCACCTTTGTGTGCCCCACGGAGATCATTGCTTTCAGTGATAGGGCAGAAGAATTTAAGAAACTCAACTGCCAAGTGATTGGTGCTTCTGTGGATTCTCACTTCTGTCATCTAGCATGGGTCAATACACCTAAGAAACAAGGAGGACTGGGACCCATGAACATTCCTTTGGTATCAGACCCGAAGCGCACCATTGCTCAGGATTATGGGGTCTTAAAGGCTGATGAAGGCATCTCGTTCAGGGGCCTTTTTATCATTGATGATAAGGGTATTCTTCGGCAGATCACTGTAAATGACCTCCCTGTTGGCCGCTCTGTGGATGAGACTTTGAGACTAGTTCAGGCCTTCCAGTTCACTGACAAACATGGGGAAGTGTGCCCAGCTGGCTGGAAACCTGGCAGTGATACCATCAAGCCTGATGTCCAAAAGAGCAAAGAATATTTCTCCAAGCAGAAGTGAGCGCTGGGCTGTTTTAGTGCCAGGCTGCGGTGGGCAGCCATGAGAACAAAACCTCTTCTGTATTTTTTTTTTCCATTAGTAAAACACAAGACTTCAGATTCAGCCGAATTGTGGTGTCTTACAAGGCAGGCCTTTCCTACAGGGGGTGGAGAGACCAGCCTTTCTTCCTTTGGTAGGAATGGCCTGAGTTGGCGTTGTGGGCAGGCTACTGGTTTGTATGATGTATTAGTAGAGCAACCCATTAATCTTTTGTAGTTTGTATTAAACTTGAACTGAGACCTTGATGAGTCTTTATTTTAGGAAGCATATTATTAGCTTTTGATTTTAAGAGGAA