Transcript asmbl_84167

Sequence
Transcript Sequence for observation asmbl_84167 of TGE0056633:
GATTCCCAACTTTGCTCAAAGTCGCTGGACTCTAAGCTGTCGGAGGGACCGCTGGACAGACCTGGGAACTGACAGAGGGCCTGGAGGGAAACAGGCCAAAGACCCACAGGCAGAGTTGACACGGAACCCCAAAGCAAGGAGGAGGGCTCGGGCCCGAGACCGTTCACCTCCCCTTATCCCTGTTCCCCTCTTCAGGATGGAGCTGACCTCAAGGGAAAGAGGGAGGGGACAGCCTCTGCCCTGGGAACTTCGACTGGGCCTACTGCTAAGCGTGCTGGCTGCCACACTGGCACAGGCCCCTGCCCCGGATGTGCCTGGCTGTTCCAGGGGAAGCTGCTACCCCGCCACGGGCGACCTGCTGGTGGGCCGAGCTGACAGACTGACTGCCTCATCCACTTGTGGCCTGAATGGCCCCCAGCCCTACTGCATCGTCAGTCACCTGCAGGACGAAAAGAAGTGCTTCCTTTGTGACTCCCGGCGCCCCTTCTCTGCTAGAGACAACCCACACAGCCATCGCATCCAGAATGTAGTCACCAGCTTTGCACCACAGCGGCGGGCAGCCTGGTGGCAGTCAGAGAATGGTATCCCTGCGGTCACCATCCAGCTGGACCTGGAGGCTGAGTTTCATTTCACACACCTCATTATGACCTTCAAGACATTTCGCCCTGCTGCCATGCTGGTGGAACGCTCAGCAGACTTTGGCCGCACCTGGCATGTGTACCGATATTTCTCCTATGACTGTGGGGCTGACTTCCCAGGAGTCCCACTAGCACCCCCACGGCACTGGGATGATGTAGTCTGTGAGTCCCGCTACTCAGAGATTGAGCCATCCACTGAAGGCGAGGTCATCTATCGTGTGCTGGACCCTGCCATCCCTATCCCAGACCCCTACAGCTCACGGATTCAGAACCTGTTGAAGATCACCAACCTACGGGTGAACCTGACTCGTCTACACACGTTGGGAGACAACCTACTCGACCCACGGAGGGAGATCCGAGAGAAGTACTACTATGCCCTCTATGAGCTGGTTGTACGTGGCAACTGCTTCTGCTACGGACACGCCTCAGAGTGTGCACCCGCCCCAGGGGCACCAGCCCATGCTGAGGGCATGGTGCACGGAGCTTGCATCTGCAAACACAACACACGTGGCCTCAACTGCGAGCAGTGTCAGGATTTCTATCGTGACCTGCCCTGGCGTCCGGCTGAGGACGGCCATAGTCATGCCTGTAGGAAGTGTGAGTGCCATGGGCACACCCACAGCTGCCACTTCGACATGGCCGTATACCTGGCATCTGGCAATGTGAGTGGAGGTGTGTGTGATGGATGTCAGCATAACACAGCTGGGCGCCACTGTGAGCTCTGTCGGCCCTTCTTCTACCGTGACCCAACCAAGGACCTGCGGGATCCGGCTGTGTGCCGCTCCTGTGATTGTGACCCCATGGGTTCTCAAGACGGTGGTCGCTGTGATTCCCATGATGACCCTGCACTGGGACTGGTCTCCGGCCAGTGTCGCTGCAAAGAACATGTGGTGGGCACTCGCTGCCAGCAATGCCGTGATGGCTTCTTTGGGCTCAGCATCAGTGACCGTCTGGGCTGCCGGCGATGTCAATGTAATGCACGGGGCACAGTGCCTGGGAGCACTCCTTGTGACCCCAACAGTGGATCCTGTTACTGCAAACGTCTAGTGACTGGACGTGGATGTGACCGCTGCCTGCCTGGCCACTGGGGCCTGAGCCACGACCTGCTCGGCTGCCGCCCCTGTGACTGCGACGTGGGTGGTGCTTTGGATCCCCAGTGTGATGAGGGCACAGGTCAATGCCACTGCCGCCAGCACATGGTTGGGCGACGCTGTGAGCAGGTGCAACCTGGCTACTTCCGGCCCTTCCTGGACCACCTAATTTGGGAGGCTGAGGACACCCGAGGGCAGGTGCTCGATGTGGTGGAGCGCCTGGTGACCCCCGGGGAAACTCCATCCTGGACTGGCTCAGGCTTCGTGCGGCTACAGGAAGGTCAGACCCTGGAGTTCCTGGTGGCCTCTGTGCCGAAGGCTATGGACTATGACCTGCTGCTGCGCTTAGAGCCCCAGGTCCCTGAGCAATGGGCAGAGTTGGAACTGATTGTGCAGCGTCCAGGGCCTGTGCCTGCCCACAGCCTGTGTGGGCATTTGGTGCCCAAGGATGATCGCATCCAAGGGACTCTGCAACCACATGCCAGGTACTTGATATTTCCTAATCCTGTCTGCCTTGAGCCTGGTATCTCCTACAAGCTGCATCTGAAGCTGGTACGGACAGGGGGAAGTGCCCAGCCTGAGACTCCCTACTCTGGACCTGGCCTGCTCATTGACTCGCTGGTGCTGCTGCCCCGTGTCCTGGTGCTAGAGATGTTTAGTGGGGGTGATGCTGCTGCCCTGGAGCGCCAGGCCACCTTTGAACGCTACCAATGCCATGAGGAGGGTCTGGTGCCCAGCAAGACTTCTCCCTCTGAGGCCTGCGCACCCCTCCTCATCAGCCTGTCCACCCTCATCTACAATGGTGCCCTGCCATGTCAGTGCAACCCTCAAGGTTCACTGAGTTCTGAGTGCAACCCTCATGGTGGTCAGTGCCTGTGCAAGCCTGGAGTGGTTGGGCGCCGCTGTGACCTCTGTGCCCCTGGCTACTATGGCTTTGGCCCCACAGGCTGTCAAGCCTGCCAGTGCAGCCACGAGGGGGCACTCAGCAGTCTCTGTGAAAAGACCAGTGGGCAATGTCTCTGTCGAACTGGTGCCTTTGGGCTTCGCTGTGACCGCTGCCAGCGTGGCCAGTGGGGATTCCCTAGCTGCCGGCCATGTGTCTGCAATGGGCATGCAGATGAGTGCAACACCCACACAGGCGCTTGCCTGGGCTGCCGTGATCACACAGGGGGTGAGCACTGTGAAAGGTGCATTGCTGGTTTCCACGGGGACCCACGGCTGCCATATGGGGGCCAGTGCCGGCCCTGTCCCTGTCCTGAAGGCCCTGGGAGCCAACGGCACTTTGCTACTTCTTGCCACCAGGATGAATATTCCCAGCAGATTGTGTGCCACTGCCGGGCAGGCTATACGGGGCTGCGATGTGAAGCTTGTGCCCCTGGGCACTTTGGGGACCCATCAAGGCCAGGTGGCCGGTGCCAACTGTGTGAGTGCAGTGGGAACATTGACCCAATGGATCCTGATGCCTGTGACCCCCACACGGGGCAATGCCTGCGCTGTTTACACCACACAGAGGGTCCACACTGTGCCCACTGCAAGCCTGGCTTCCATGGGCAGGCTGCCCGACAGAGCTGTCACCGCTGCACATGCAACCTGCTGGGCACAAATCCGCAGCAGTGCCCATCTCCTGACCAGTGCCACTGTGATCCAAGCAGTGGGCAGTGCCCATGCCTCCCCAATGTCCAGGGCCCTAGCTGTGACCGCTGTGCCCCCAACTTCTGGAACCTCACCAGTGGCCATGGTTGCCAGCCTTGTGCCTGCCACCCAAGCCGGGCCAGAGGCCCCACCTGCAACGAGTTCACAGGGCAGTGCCACTGCCGTGCCGGCTTTGGAGGGCGGACTTGTTCTGAGTGCCAAGAGCTCCACTGGGGAGACCCTGGGTTGCAGTGCCATGCCTGTGATTGTGACTCTCGTGGAATAGATACACCTCAGTGTCACCGCTTCACAGGTCACTGCAGCTGCCGCCCAGGGGTGTCTGGTGTGCGCTGTGACCAGTGTGCCCGTGGCTTCTCAGGAATCTTTCCTGCCTGCCATCCCTGCCATGCATGCTTCGGGGATTGGGACCGAGTGGTGCAGGACTTGGCAGCCCGTACACAGCGCCTAGAGCAGCGGGCGCAGGAGTTGCAACAGACGGGTGTGCTGGGTGCCTTTGAGAGCAGCTTCTGGCACATGCAGGAGAAGCTGGGCATTGTGCAGGGCATCGTAGGTGCCCGCAACACCTCAGCCGCCTCCACTGCACAGCTTGTGGAGGCCACAGAGGAGCTGCGGCGTGAAATTGGGGAGGCCACTGAGCACCTGACTCAGCTCGAGGCAGACCTGACAGATGTGCAAGATGAGAACTTCAATGCCAACCATGCACTAAGTGGTCTGGAGCGAGATAGGCTTGCACTTAATCTCACACTGCGGCAGCTCGACCAGCATCTTGACTTGCTCAAACATTCAAACTTCCTGGGTGCCTATGACAGCATCCGGCATGCCCATAGCCAGTCTGCAGAGGCAGAACGTCGTGCCAATACCTCAGCCCTGGCAGTACCTAGCCCTGTGAGCAACTCGGCAAGTGCTCGGCATCGGACAGAGGCACTGATGGATGCTCAGAAGGAGGACTTCAACAGCAAACACATGGCCAACCAGCGGGCACTTGGCAAGCTCTCTGCCCATACCCACACCCTGAGCCTGACAGACATAAATGAGCTGGTGAGGTTGAAGTGTTGGGTGGGGCAGGTGGGTGTAGATGTTCCTCTCACAGGGCCCTGACTTGTTCTGTGCCTGGCAGGTGTGTGGGGCACCAGGGGATGCACCCTGTGCTACAAGCCCTTGTGGGGGTGCCGGCTGTCGAGATGAGGATGGGCAGCCGCGCTGTGGGGGCCTCAGCTGCAATGGGGCAGCGGCTACAGCAGACCTAGCACTGGGCCGGGCCCGGCACACACAGGCAGAGCTGCAGCGGGCACTGGCAGAAGGTGGTAGCATCCTCAGCAGAGTGGCTGAGACTCGTCGGCAGGCAAGCGAGGCACAGCAGCGGGCCCAGGCAGCCCTGGACAAGGCTAATGCTTCCAGGGGACAGGTGGAACAGGCCAACCAGGAACTTCAAGAACTTATCCAGAGTGTGAAGGACTTCCTCAACCAGGAGGGGGCTGATCCTGATAGCATTGAAATGGTGGCCACACGGGTGCTAGAGCTCTCCATCCCAGCTTCAGCTGAGCAGATCCAGCACCTGGCGGGTGCGATTGCAGAGCGAGTCCGGAGCCTGGCAGATGTGGATGCGATCCTGGCACGTACTGTAGGAGATGTGCGTCGTGCCGAGCAGCTACTGCAGGATGCACGGCGGGCAAGGAGCTGGGCTGAGGATGAGAAACAGAAGGCAGAGACAGTACAGGCAGCACTGGAGGAGGCCCAGCGGGCACAGGGTATTGCCCAGGGTGCCATCCGGGGGGCAGTGGCTGACACACGGGACACAGAGCAGACCCTGTACCAGGTACAGGAGAGGATGGCAGGTGCAGAGCGGGCACTGAGCTCTGCAGGTGAAAGGGCTCGGCAGTTGGATGCTCTCCTGGAGGCTCTGAAATTGAAACGGGCAGGAAATAGTCTGGCAGCCTCTACAGCAGAAGAAACGGCAGGCAGTGCCCAGGGTCGTGCCCAGGAGGCTGAGCAGCTGCTACGCGGTCCTCTGGGTGATCAGTACCAGACGGTGAAGGCCCTAGCTGAGCGCAAGGCCCAAGGTGTGCTGGCTGCACAGGCAAGGGCAGAACAACTGCGGGATGAGGCTCGGGACCTGTTGCAAGCCGCTCAGGACAAGCTGCAGCGGCTACAGGAATTGGAAGGCACCTATGAGGAAAATGAGCGGGCACTGGAGAGTAAGGCAGCCCAGTTGGACGGGTTGGAGGCCAGGATGCGCAGCGTGCTTCAAGCCATCAACTTGCAGGTGCAGATCTACAACACCTGCCAGTGACCCCTGCCCAAGGCCTACCCCAGTTCCTAGCACTGCCCCACATGCATGTCTGCCTATGCACTGAAGAGCTCTTGGCCCGGCAGGGCCCCCAATAAACCAGTGTGAACCCCC