Transcript asmbl_57890

Sequence
Transcript Sequence for observation asmbl_57890 of TGE0056581:
GGTCGGCCCCGGGACGCGCGCAGCCGGCCCGCAGTTGCCGCTGTCGTCCGCAGAGCCAGTTCCTAGCGCAGAGCCGCGCCCGCCATGAGGGAGATCGTGCACATCCAGGCGGGCCAGTGCGGGAACCAGATCGGCACCAAGTTTTGGGAAGTGATCAGCGATGAGCACGGCATCGACCCGGCCGGAGGCTACGTGGGAGACTCGGCGCTGCAGCTGGAGAGAATCAACGTCTACTACAATGAGTCATCGTCTCAGAAATATGTGCCCAGGGCCGCCCTGGTGGACTTAGAGCCAGGCACCATGGACAGCGTGCGGTCTGGGCCTTTTGGGCAGCTTTTCCGGCCTGACAACTTCATCTTTGGCCAGACGGGTGCAGGGAACAACTGGGCGAAAGGGCACTACACGGAGGGCGCGGAGCTGGTGGACGCAGTGCTGGACGTGGTGCGGAAGGAGTGCGAGCACTGCGACTGCCTGCAGGGCTTCCAGCTCACGCACTCGCTGGGCGGCGGCACGGGCTCAGGCATGGGCACGCTGCTCATCAGCAAGATCCGTGAGGAGTTCCCGGACCGCATCATGAACACCTTCAGCGTCATGCCCTCGCCCAAGGTGTCGGACACGGTGGTGGAGCCCTACAATGCCACACTGTCGGTGCACCAGCTGGTGGAGAATACAGACGAGACCTACTGCATCGACAACGAGGCGCTCTATGACATCTGCTTCCGCACTCTGAAGCTGACAACGCCCACCTACGGGGACCTCAACCACCTGGTGTCCGCCACCATGAGTGGGGTCACCACCTCGCTGCGCTTCCCGGGCCAGCTCAATGCTGACCTGCGCAAGCTGGCGGTGAACATGGTGCCCTTCCCGCGCCTGCACTTCTTCATGCCTGGCTTCGCGCCGCTCACCAGCCGCGGCAGCCAGCAGTACCGGGCCCTGACCGTGCCCGAGCTCACCCAGCAGATGTTCGACGCCAGGAACATGATGGCCGCCTGCGATCCGCGCCATGGCCGCTACCTGACCGTGGCCACCGTGTTCCGCGGGCCCATGTCCATGAAGGAGGTGGACGAGCAGATGCTGGCCATCCAGAGTAAGAACAGCAGCTACTTCGTGGAGTGGATTCCCAACAACGTGAAGGTGGCCGTGTGCGACATCCCGCCCCGCGGCCTGAAGATGGCCTCCACCTTCATCGGCAACAGCACGGCCATCCAGGAGCTGTTCAAGCGCATCTCCGAGCAGTTCTCAGCCATGTTCCGGCGCAAGGCCTTCCTGCACTGGTTCACGGGTGAGGGCATGGATGAAATGGAGTTCACCGAGGCGGAGAGCAACATGAACGACCTGGTATCCGAGTACCAGCAGTACCAGGATGCCACCGCCAATGACGGGGAGGAAGCTTTTGAGGATGAGGAAGAGGAGATCGATGGATAGTCGGAATAGAGCCGCCCCAACTCAGATCCTACAACACGCAAGTTCCTTCTTGAACCCTGGTGCCTCCTACCCTATGGCCCTGAATGGTGCACTGGTTTAATTGTGTTGGTGTCGGCCCCTCACAAATGCAGCCAAGTCATGTAATTAGTCATCTGGAACAAAGACTAAAAACAGCAGAGAATTGCGGGTTCTACCCAGTCAGAAGATCACACCATGGAGACTTTCTACTAGAGGACTTGAAAGAGAACTGAGGGGCCACAAAATAAACTTCACCTTCCATTAAGTGTTCAAGCATGTCTGCAAATTAGGAGGGAGTTAGAAACAGTCTTTTTCATCCTTTGTGATGAAGCCTGAAATTGTGCCGTGTTGCCTTATATGAATATGCAGTATGGGACTTTGAAATAATGATTCATAATAAAATACTAAACGTGTGTCTTCA