Transcript asmbl_56656

Sequence
Transcript Sequence for observation asmbl_56656 of TGE0056578:
GTGGCATCCTGGTACTGCTGGTACTCGGATACCAGGTCGTTCATGTTGCTCTCCGCCTCGGTGAACTCCATTTCATCCATGCCCTCACCCGTGAACCAGTGCAGGAAGGCCTTGCGCCGGAACATGGCTGAGAACTGCTCGGAGATGCGCTTGAACAGCTCCTGGATGGCCGTGCTGTTGCCGATGAAGGTGGAGGCCATCTTCAGGCCGCGGGGCGGGATGTCGCACACGGCCACCTTCACGTTGTTGGGAATCCACTCCACGAAGTAGCTGCTGTTCTTACTCTGGATGGCCAGCATCTGCTCGTCCACCTCCTTCATGGACATGGGCCCGCGGAACACGGTGGCCACGGTCAGGTAGCGGCCATGGCGCGGATCGCAGGCGGCCATCATGTTCCTGGCGTCGAACATCTGCTGGGTGAGCTCGGGCACGGTCAGGGCCCGGTACTGCTGGCTGCCGCGGCTGGTGAGCGGCGCGAAGCCAGGCATGAAGAAGTGCAGGCGCGGGAAGGGCACCATGTTCACCGCCAGCTTGCGCAGGTCAGCATTGAGCTGGCCCGGGAAGCGCAGCGAGGTGGTGACCCCACTCATGGTGGCGGACACCAGGTGGTTGAGGTCCCCGTAGGTGGGCGTTGTCAGCTTCAGAGTGCGGAAGCAGATGTCATAGAGCGCCTCGTTGTCGATGCAGTAGGTCTCGTCTGTATTCTCCACCAGCTGGTGCACCGACAGTGTGGCATTGTAGGGCTCCACCACCGTGTCCGACACCTTGGGCGAGGGCATGACGCTGAAGGTGTTCATGATGCGGTCCGGGAACTCCTCACGGATCTTGCTGATGAGCAGCGTGCCCATGCCTGAGCCCGTGCCGCCGCCCAGCGAGTGCGTGAGCTGGAAGCCCTGCAGGCAGTCGCAGTGCTCGCACTCCTTCCGCACCACGTCCAGCACTGCGTCCACCAGCTCCGCGCCCTCCGTGTAGTGCCCTTTCGCCCAGTTGTTCCCTGCACCCGTCTGGCCTGCAACAAAGAGAGTCCCGTGCCGTTTAAACAGGAAAGGGCTGCGCCATCACCATGCTTGGTCACCGACAAGGAGGGTGTGAAGTGATTCCATGATGTGCTGTTAGCCAAAGGGAGGGGCCGGGGAAACAGGCACCCACCAACGGTGCAGCTGAGCAGATGCACTGGTACGTTTTTAGGCAAGTCAAAGTAGCTACTGGTCAATTTTAAAGATGTATATACATTTTGACCTGGTTGTTCCATGTTAAAGAGGTAATTCTTGCACATGGTAGAATTCAAAGGGAACAAAAGGTATACATTAAAAAAATAAGTTACTGGCCGGGCGCCGTGGCTCATGCCTGTAA