Transcript asmbl_53808

Sequence
Transcript Sequence for observation asmbl_53808 of TGE0056256:
GTCAGGAGAGGCTGCTCTGCACAGATCCTGCTCCTTCCCAGTGCTGCATTATCTTGAAATTTTCCTTCCCCTTCCCCCTAGCCCCAACTCTCCCCAACTCCAACCCTGACCCAGAAAGTAGAGTGATTTGGAGGCTGGAAGACAAAACCATGTAAGGTCTGTGGAAATCACAGCTGTTCAGACCCGCCTCCAACCCCGGCCACCCCGCCCCCTTGCCCTAGCCTTCCTGTGTCCTTCCCACCCTTAGTCCCAGGCATCTGACTACCGGGAACCTCAGCCAGAGTCCGGGAGCCCCCCACCCCGTCCAGGAGCCAACAGAGCCCCCGTCTTGCTGGCGTGAGAATACATTGCTCTCCTTTGGTTGAATCAGCTGTCCCTCTTCGTGGGAAAATGAACCAGAAGACAATCCTCGTGCTCCTCATTCTGGCCGTCATCACCATCTTTGCCTTGGTTTGTGTCCTGCTGGTGGGCAGGGGTGGAGATGGGGGTGAACCCAGCCAGCTTCCCCATTGCCCCTCTGTATCTCCCAGTGCCCAGCCTTGGACACACCCTGGCCAGAGCCAGCTGTTTGCAGACCTGAGCCGAGAGGAGCTGACGGCTGTGATGCGCTTTCTGACCCAGCGGCTGGGGCCAGGGCTGGTGGATGCAGCCCAGGCCCGGCCCTCGGACAACTGTGTCTTCTCAGTGGAGTTGCAGCTGCCTCCCAAGGCTGCAGCCCTGGCTCACTTGGACAGGGGGAGCCCCCCACCTGCCCGGGAGGCACTGGCCATCGTCTTCTTTGGCAGGCAACCCCAGCCCAACGTGAGTGAGCTGGTGGTGGGGCCACTGCCTCACCCCTCCTACATGCGGGACGTGACTGTGGAGCGTCATGGAGGCCCCCTGCCCTATCACCGACGCCCCGTGCTGTTCCAAGAGTACCTGGACATAGACCAGATGATCTTCAACAGAGAGCTGCCCCAGGCTTCTGGGCTTCTCCACCACTGTTGCTTCTACAAGCACCGGGGACGGAACCTGGTGACAATGACCACGGCTCCCCGTGGTCTGCAATCAGGGGACCGGGCCACCTGGTTTGGCCTCTACTACAACATCTCGGGCGCTGGGTTCTTCCTGCACCACGTGGGCTTGGAGCTGCTAGTGAACCACAAGGCCCTTGACCCTGCCCGCTGGACTATCCAGAAGGTGTTCTATCAAGGCCGCTACTACGACAGCCTGGCCCAGCTGGAGGCCCAGTTTGAGGCCGGCCTGGTGAATGTGGTGCTGATCCCAGACAATGGCACAGGTGGGTCCTGGTCCCTGAAGTCCCCTGTGCCCCCGGGTCCAGCTCCCCCTCTACAGTTCTATCCCCAAGGCCCCCGCTTCAGTGTCCAGGGAAGTCGAGTGGCCTCCTCACTGTGGACTTTCTCCTTTGGCCTCGGAGCATTCAGTGGCCCAAGGATCTTTGACGTTCGCTTCCAAGGAGAAAGACTAGTTTATGAGATAAGCCTCCAAGAGGCCTTGGCCATCTATGGTGGAAATTCCCCAGCAGCAATGACGACCCGCTATGTGGATGGAGGCTTTGGCATGGGCAAGTACACCACGCCCCTGACCCGTGGGGTGGACTGCCCCTACTTGGCCACCTACGTGGACTGGCACTTCCTTTTGGAGTCCCAGGCCCCCAAGACAATACGTGATGCCTTTTGTGTGTTTGAACAGAACCAGGGCCTCCCCCTGCGGCGACACCACTCAGATCTCTACTCGCACTACTTTGGGGGTCTTGCGGAAACGGTGCTGGTCGTCAGATCTATGTCCACCTTGCTCAACTATGACTATGTGTGGGATACGGTCTTCCACCCCAGTGGGGCCATAGAAATACGATTCTATGCCACGGGCTACATCAGCTCGGCATTCCTCTTTGGTGCTACTGGGAAGTACGGGAACCAAGTGTCAGAGCACACCCTGGGCACGGTCCACACCCACAGCGCCCACTTCAAGGTGGATCTGGATGTAGCAGGACTGGAGAACTGGGTCTGGGCCGAGGATATGGTCTTTGTCCCCATGGCTGTGCCCTGGAGCCCTGAGCACCAGCTGCAGAGGCTGCAGGTGACCCGGAAGCTGCTGGAGATGGAGGAGCAGGCCGCCTTCCTCGTGGGAAGCGCCACCCCTCGCTACCTGTACCTGGCCAGCAACCACAGCAACAAGTGGGGTCACCCCCGGGGCTACCGCATCCAGATGCTCAGCTTTGCTGGAGAGCCGCTGCCCCAAAACAGCTCCATGGCGAGAGGCTTCAGCTGGGAGAGGTACCAGCTGGCTGTGACCCAGCGGAAGGAGGAGGAGCCCAGTAGCAGCAGCGTTTTCAATCAGAATGACCCTTGGGCCCCCACTGTGGATTTCAGTGACTTCATCAACAATGAGACCATTGCTGGAAAGGATTTGGTGGCCTGGGTGACAGCTGGTTTTCTGCATATCCCACATGCAGAGGACATTCCTAACACAGTGACTGTGGGGAACGGCGTGGGCTTCTTCCTCCGACCCTATAACTTCTTTGACGAAGACCCCTCCTTCTACTCTGCCGACTCCATCTACTTCCGAGGGGACCAGGATGCTGGGGCCTGCGAGGTCAACCCCCTAGCTTGCCTGCCCCAGGCTGCTGCCTGTGCCCCCGACCTCCCTGCCTTCTCCCACGGGGGCTTCTCTCACAACTAGGCGGTCCTGGGATGGGGCATGTGGCCAAGGGCTCCAGGGCCAGGGTGTGAGGGATGGGGAGCAGCTGGGCACTGGGCCGGCAGCCTGGTTCCCTCTTTCCTGTGCCAGGACTCTCTTTCTTCCACTACCCTCCCTCGCATCCGCCTCTGAGCCAGGAGCCTCCTGACCCTGTGATGCCTGACACAGGGGACACTGAACCTTGTTGATGCCAGCTGTACTGAGTTCTCATCCACAGAGGCCAGGCATGGCCCAGCCTGGAGCCGTGGCCGAGGGCTTCCCTAGATGGTTCCCTTTGTTGCTGTCTGGCTTTCCCGAATCTTTTTAGGCCACCTCCAAGGACTCTAAAAGGGGGCTATTCCCTGGAGACCCCAGAGTAGGGTTGCCAGTCCTGCAAGTCCATAGCTGAGCTGGAAAGGATGCTTCTGCTCACATTCCCTCTCATCCAGGTCCTTTCCTTCTCGTCTTCCTCTCTCTCACCTACTTCCTCCTCCTCCTCCTGTTCCTGCCTTCTCTTCTATCCTGCAATTTCTCCCGAATCCTGAGGGGATATCCCTATGTCCCAGCCCCTGGTACTCCCCCAGCCCTCAGTTTTCAGTCAAGTTCCGTCTCCTCTCCAGCCCTATGGAAGTCTCAAGGTCACGGGACCCCTAATCAGAGTGGCCAATCCCTGTGTGTCGTTCCCTTGTGTCTGTTGCTTATTGGGAGTAGGAGTTGCTCCTACCCCTGTCCTGGGGCTGGGTGTGTTTCAGGACAGCTGCTTCTGTGCATTTGTGTCTGCCTGCCTCATGCTCTCTATAGAGGAGGATGGTCATCGTGACAGCAGCAGCTCAAGTTAGCATTTCAAGTGATTTGGGGGTGCAATGATAATGAAGAATGGCCATTTTGTACCAGGGCTCTGTATTCTGCAACAGCCTGTTTGGGAGGCTGGAGTGGAAACAAAGGGTGGGCATCAAAGATGAGAAGCCAAAGCCCCTACAACTCCAGCCACCCAGCCAGGAGGGGCTGTCCAATCACATTCAGGCATGCGAATGAGCTGGGCCCTGGGTGAGGTGGGGGTCTGGCCTAGTGGGGAGGGGCCTGGCCTGGGTGGGGCAGGGCCTGGCCTGGTCCAGGCTTGGGCTCCATTCCCATCACTGCTGTCCCTCCTGAGGTCTGGATTGGGGATGGGGACAAAGAAATAGCAAGAGATGAGAAACAACAGAAACTTTTTTCTCTAAAGGACTGGTTAAATCAATTCTGATACAGCCTTACAATACAATAGTATGCAGCTAAAAAATAATTGTATGTCTTTATATACTAATATGTAATAATCTTCAGGTGAAAAAGGCAAGCCACAGAAATGTGTATAGCGCACTTCCCATTTGTGTTTCAGAAAGGAGTAGAATATAAACACATAATTGCTTATGTATGCCTATTCAGAATAAATGGGTAACACTGATTACTTTTGGGAGGGGAACCAGTAGGTTGAGGACAGGAGAGGGAAGGGTCTTAACACTTACACCCTTTTGTACATTTTGAATTTTGAACCATGTGACTGTATTACCTATTCAAAATAAACAATAAATGGGCCCAA