Transcript asmbl_17735

Sequence
Transcript Sequence for observation asmbl_17735 of TGE0001731:
AGTGCCTTTCATCTGAGAAGTTCAAGGCACTTCGTAGAACTTCTGCCACACAGGCCGTGGGTCTTGCAGCACATTTGTAAGCAATGGCTGCCATCAGGAAGAAATTGGTGATTGTTGGTGATGGAGCCTGTGGCAAGACCTGCTTGCTTATCGTTTTTAGCAAGGACCAGTTTCCAGAGGTGTATGTACCCACAGTGTTTGAGAACTATGTGGCAGATATTGAAGTGGATGGAAAGCAGGTAGAGTTGGCTTTGTGGGACACAGCTGGGCAGGAAGATTATGATCGCTTGAGGCCCCTCTCCTACCCGGACACTGATGTTATACTGATGTGTTTCTCCATTGACAGCCCTGATAGTTTAGAAAACATCCCAGAAAAATGGACTCCGGAAGTCAAGCATTTCTGTCCCAATGTGCCCATCATCCTGGTTGGAAACAAGAAGGACCTTCGGAATGATGAGCACACAAGGCGGGAGCTAGCCAAGATGAAGCAGGAGCCGGTAAAACCAGAAGAAGGCAGAGATATGGCGAACAGGATTGGCGCTTTTGGGTACATGGAGTGTTCAGCAAAAACCAAAGATGGAGTGAGGGAGGTTTTTGAAATGGCCACGAGAGCTGCTCTGCAAGCCAGACGTGGGAAGAAAAAATCTGGGTGCCTTGTCTTGTGAAACCCTGCTGCAAGCACAGCCCTCATGCGGTTAATTTTGAAGTGCTGTTTATTAATCTTAGTGTATGATTACTGGCCTTTTTCATTTATCTATAATTTACCTAAGATTACAAATCAGAAGTCATCCTGCTACCAGTATTTAGAAGCCAAGCCAACCATGATTATTAATGATGTCCAGCCCACCTGACCCGCCGGGGGCCTTCTGACACCGCTCTAACAGCCCTCCTCTGCACTCCACCTGACACACCAGGCACTAATTCAAGGGATTTCTTAACTTCTTGCTTCTTTCTAGAAAGAGAAATGGTAACTTTTGTGAATTAGGCTGTAACTACTTCATAACTAACATGTCTTGCCTCTCATCTGTCAGCTGCAACGTATTCTGGTGAGTCACCACTTCAGAGCTTTACTCCTTAACAGATTGCATTGGCATAGCTCTGGAGTGGCCATCCAGTTTTTTCAAAATGGGCTCAGCCAGAAAGGCCCAAGTCCATGCAGCTGTGGCAAAGTTACAGTTCTGTGGTTTCATGTTAGTTACCTTATAGTTACTGTGTAATTAGTGCCACTTAATGTATGTTACCAAAAATAAATATATCTACCCCAGACTAGATGTAGTATTTTTTGTATAATTGGATTTCCTAATACTGATATTTGTCATCCCCACAGAAAGTGTATTGGTTTTTTAAAAAAGAAAGTGTATTTGAAAATAAAGTCAGATGGAAAATTCATTTTTTAAATTCCCGTTTTGTCAGTTTCTCTGATAAAAGATGACCATCTCACCTGTTTTCAGCCCCACATGTCCCAGTCCCCCTCCCCAGAGCTGGGCTAAGTAAGTAGGAATTTGGTTTCAAGCGCCCGAGGCACTCAGACACTTCTGAAGGTGGCACAACCTGTCTGGACCGCAGGGTCGGCCTCTAGTTCACAGTGCTTTCTCCTCACTGTATCTAGGTTCCCTCCCAGAGGAGCCACCAGTTCTCGTGGGTGGCACTGTGTTTCTCTCCTCTCCAGCTGACTAAACTTTTTTTCTGTACCAGTTAATTTTTCCAACTACTAATAGAATAAAGGCAGTTTTCTAAA