Transcript asmbl_43577

Sequence
Transcript Sequence for observation asmbl_43577 of TGE0056544:
GAAAAAAGCTTTTCCAAAAAAGTATTGGCTGTCTTGAGGAATGCGGTCGCCCCCTTGGGAAAGTACATATCTGGGAGAAGCAGGCGGCTCCGCGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAGGGCCCCTCGCCGCCGCCACCATGGACGCCATCAAGAAGAAGATGCAGATGCTGAAGCTCGACAAGGAGAACGCCTTGGATCGAGCTGAGCAGGCGGAGGCCGACAAGAAGGCGGCGGAAGACAGGAGCAAGCAGCTGGAAGATGAGCTGGTGTCACTGCAAAAGAAACTCAAGGGCACCGAAGATGAACTGGACAAATACTCTGAGGCTCTCAAAGATGCCCAGGAGAAGCTGGAGCTGGCAGAGAAAAAGGCCACCGATGCTGAAGCCGACGTAGCTTCTCTGAACAGACGCATCCAGCTGGTTGAGGAAGAGTTGGATCGTGCCCAGGAGCGTCTGGCAACAGCTTTGCAGAAGCTGGAGGAAGCTGAGAAGGCAGCAGATGAGAGTGAGAGAGGCATGAAAGTCATTGAGAGTCGAGCCCAAAAAGATGAAGAAAAAATGGAAATTCAGGAGATCCAACTGAAAGAGGCCAAGCACATTGCTGAAGATGCCGACCGCAAATATGAAGAGGTGGCCCGTAAGCTGGTCATCATTGAGAGCGACCTGGAACGTGCAGAGGAGCGGGCTGAGCTCTCAGAAGGCCAAGTCCGACAGCTGGAAGAACAATTAAGAATAATGGATCAGACCTTGAAAGCATTAATGGCTGCAGAGGATAAGTACTCGCAGAAGGAAGACAGATATGAGGAAGAGATCAAGGTCCTTTCCGACAAGCTGAAGGAGGCTGAGACTCGGGCTGAGTTTGCGGAGAGGTCAGTAACTAAATTGGAGAAAAGCATTGATGACTTAGAAGACGAGCTGTACGCTCAGAAACTGAAGTACAAAGCCATCAGCGAGGAGCTGGACCACGCTCTCAACGATATGACTTCCATGTAAACGTTCATCCACTCTGCCTGCTTACACCCTGCCCTCATGCTAATGTAATAAACTCACCACCATGCCTTCCTTGCTCCCTAATCTCCATCTTTGCACTCTTGTGTTCACCCTTTTTGTCATAACCTAGAATAGTCATTGTTTTTTCACTTTCTGCTAATATAAAGGCCAATTAGATTAAGTCTGTCTATACAAACCATTTTCTTTTCAGAATCCGTTTATTTTGTAAACGCTGAACTAGAGCAGTGAACTAGAATGAGTGACCTTGAGCACTGTCCTTTTGGGAAATTAAGCTAAACTCAAGTAAAACTAGAAGGCCATGCCGTTTGTTGTACAGGAACTTCTCAAAAAATATCAAAATTTGTTTCCTGAAATTCAACTAAGTACAACATAATCATTTTCGTTAAATATAATTTGAAGGAACCCTTAAAGTGTCAGGTTATTGAGAATCTGAGGATAAGGAAATTGGCATGATCCAATACAGCTTTAACAGTGGTACTACAAAAGATCATCTCTTTTACTTTTAAGAATTCTAGAGTAGGCCGGGCACAGTGGCTCACGCC