Transcript asmbl_40212

Sequence
Transcript Sequence for observation asmbl_40212 of TGE0056539:
CAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGTGTGCTCGCCCACTGATATCGGTGTACTCCGAAAAGGGGGAGTCATCTGGCAAAAATGTCACTTTGCCTGCTGTATTCAAGGCTCCTATTCGACCAGATATTGTGAACTTTGTTCACACCAACTTGCGCAAAAACAACAGACAGCCCTATGCTGTCAGTGAATTAGCAGGTCATCAGACTAGTGCTGAGTCTTGGGGTACTGGCAGAGCTGTGGCTCGAATTCCCAGAGTTCGAGGTGGTGGGACTCACCGCTCTGGCCAGGGTGCTTTTGGAAACATGTGTCGTGGAGGCCGAATGTTTGCACCAACCAAAACCTGGCGCCGTTGGCATCGTAGAGTGAACACAACCCAAAAACGATACGCCATCTGTTCTGCCCTGGCTGCCTCAGCCCTACCAGCACTGGTCATGTCTAAAGGTCATCGTATTGAGGAAGTTCCTGAACTTCCTTTGGTAGTTGAAGATAAAGTTGAAGGCTACAAGAAGACCAAGGAAGCTGTTTTGCTCCTTAAGAAACTTAAAGCCTGGAATGATATCAAAAAGGTCTATGCCTCTCAGCGAATGAGAGCTGGCAAAGGCAAAATGAGAAACCGTCGCCGTATCCAGCGCAGGGGCCCGTGCATCATCTATAATGAGGATAATGGTATCATCAAGGCCTTCAGAAACATCCCTGGAATTACTCTGCTTAATGTAAGCAAGCTGAACATTTTGAAGCTTGCTCCTGGTGGGCATGTGGGACGTTTCTGCATTTGGACTGAAAGTGCTTTCCGGAAGTTAGATGAATTGTACGGCACTTGGCGTAAAGCCGCTTCCCTCAAGAGTAACTACAATCTTCCCATGCACAAGATGATTAATACAGATCTTAGCAGAATCTTGAAAAGCCCAGAGATCCAAAGAGCCCTTCGAGCACCACGCAAGAAGATCCATCGCAGAGTCCTAAAGAAGAACCCACTGAAAAACTTGAGAATCATGTTGAAGCTAAACCCATATGCAAAGACCATGCGCCGGAACACCATTCTTCGCCAGGCCAGGAATCACAAGCTCCGGGTGGATAAGGCAGCTGCTGCAGCAGCGGCACTACAAGCCAAATCAGATGAGAAGGCGGCGGTTGCAGGCAAGAAGCCTGTGGTAGGTAAGAAAGGAAAGAAGGCTGCTGTTGGTGTTAAGAAGCAGAAGAAGCCTCTGGTGGGAAAAAAGGCAGCAGCTACCAAGAAACCAGCCCCTGAAAAGAAGCCTGCAGAGAAGAAACCTACTACAGAGGAGAAGAAGCCTGCTGCATAAACTCTTAAATTTGATTATTCCATAAAGGTCAAATCATTTTGGACAGCTTCTTTTGAATAAAGACCTGATTATACAGGCAGTGAGAAACATGACTTGGTGTGCTCTGTAAAGCTTGGTTAGAATTTTTTTAAAGTGACATTTTGTTGGCCATAATTTAGACTGTTACATTTTATATAGTGTGGTATAAAATGGGGCATGGATTTATACTAAGTCCATGGAGTTCAGTGGAAGGGGAATGATTTAAAAAAAGTTGTGGTTTTCTAAATAATGTGGCTTGAAAAATAGGTGTAACAGGACTTGGTCAGAAACGCAGAGGCTGTTCAAGTTTAGCTCCCCACCAGATGGAAAATAGGTTAAATTCTGTAAAGATTTAACTTTAACCACAAGAGGGCACAACTGGAGAGCACAATTTTTTTGGTACTGCAGTAAAATTGATTACCTCTTGAGAAGTGTTCTTTTTAACCAGCTATAACAATAGAGTTGAGTATTTTCACCCATGGTTTGAAAAAGTGCCAGAAGGCCACA